ID: 1072591487

View in Genome Browser
Species Human (GRCh38)
Location 10:96832251-96832273
Sequence GCTGGGCGTGCGCGGGGCCG CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 746
Summary {0: 1, 1: 1, 2: 9, 3: 99, 4: 636}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1072591475_1072591487 9 Left 1072591475 10:96832219-96832241 CCGCGGGTGCGTGCGCGGCCCCG No data
Right 1072591487 10:96832251-96832273 GCTGGGCGTGCGCGGGGCCGCGG 0: 1
1: 1
2: 9
3: 99
4: 636
1072591472_1072591487 15 Left 1072591472 10:96832213-96832235 CCCGGGCCGCGGGTGCGTGCGCG No data
Right 1072591487 10:96832251-96832273 GCTGGGCGTGCGCGGGGCCGCGG 0: 1
1: 1
2: 9
3: 99
4: 636
1072591481_1072591487 -9 Left 1072591481 10:96832237-96832259 CCCCGGGCGACGCGGCTGGGCGT No data
Right 1072591487 10:96832251-96832273 GCTGGGCGTGCGCGGGGCCGCGG 0: 1
1: 1
2: 9
3: 99
4: 636
1072591473_1072591487 14 Left 1072591473 10:96832214-96832236 CCGGGCCGCGGGTGCGTGCGCGG No data
Right 1072591487 10:96832251-96832273 GCTGGGCGTGCGCGGGGCCGCGG 0: 1
1: 1
2: 9
3: 99
4: 636
1072591482_1072591487 -10 Left 1072591482 10:96832238-96832260 CCCGGGCGACGCGGCTGGGCGTG No data
Right 1072591487 10:96832251-96832273 GCTGGGCGTGCGCGGGGCCGCGG 0: 1
1: 1
2: 9
3: 99
4: 636

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1072591487 Original CRISPR GCTGGGCGTGCGCGGGGCCG CGG Intronic