ID: 1072591490

View in Genome Browser
Species Human (GRCh38)
Location 10:96832261-96832283
Sequence CGCGGGGCCGCGGCGGAGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1032
Summary {0: 1, 1: 0, 2: 17, 3: 133, 4: 881}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1072591475_1072591490 19 Left 1072591475 10:96832219-96832241 CCGCGGGTGCGTGCGCGGCCCCG No data
Right 1072591490 10:96832261-96832283 CGCGGGGCCGCGGCGGAGGCTGG 0: 1
1: 0
2: 17
3: 133
4: 881
1072591482_1072591490 0 Left 1072591482 10:96832238-96832260 CCCGGGCGACGCGGCTGGGCGTG No data
Right 1072591490 10:96832261-96832283 CGCGGGGCCGCGGCGGAGGCTGG 0: 1
1: 0
2: 17
3: 133
4: 881
1072591473_1072591490 24 Left 1072591473 10:96832214-96832236 CCGGGCCGCGGGTGCGTGCGCGG No data
Right 1072591490 10:96832261-96832283 CGCGGGGCCGCGGCGGAGGCTGG 0: 1
1: 0
2: 17
3: 133
4: 881
1072591481_1072591490 1 Left 1072591481 10:96832237-96832259 CCCCGGGCGACGCGGCTGGGCGT No data
Right 1072591490 10:96832261-96832283 CGCGGGGCCGCGGCGGAGGCTGG 0: 1
1: 0
2: 17
3: 133
4: 881
1072591483_1072591490 -1 Left 1072591483 10:96832239-96832261 CCGGGCGACGCGGCTGGGCGTGC No data
Right 1072591490 10:96832261-96832283 CGCGGGGCCGCGGCGGAGGCTGG 0: 1
1: 0
2: 17
3: 133
4: 881
1072591472_1072591490 25 Left 1072591472 10:96832213-96832235 CCCGGGCCGCGGGTGCGTGCGCG No data
Right 1072591490 10:96832261-96832283 CGCGGGGCCGCGGCGGAGGCTGG 0: 1
1: 0
2: 17
3: 133
4: 881

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1072591490 Original CRISPR CGCGGGGCCGCGGCGGAGGC TGG Intronic