ID: 1072591493

View in Genome Browser
Species Human (GRCh38)
Location 10:96832267-96832289
Sequence GCCGCGGCGGAGGCTGGGCC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1375
Summary {0: 1, 1: 1, 2: 9, 3: 123, 4: 1241}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1072591481_1072591493 7 Left 1072591481 10:96832237-96832259 CCCCGGGCGACGCGGCTGGGCGT No data
Right 1072591493 10:96832267-96832289 GCCGCGGCGGAGGCTGGGCCGGG 0: 1
1: 1
2: 9
3: 123
4: 1241
1072591473_1072591493 30 Left 1072591473 10:96832214-96832236 CCGGGCCGCGGGTGCGTGCGCGG No data
Right 1072591493 10:96832267-96832289 GCCGCGGCGGAGGCTGGGCCGGG 0: 1
1: 1
2: 9
3: 123
4: 1241
1072591483_1072591493 5 Left 1072591483 10:96832239-96832261 CCGGGCGACGCGGCTGGGCGTGC No data
Right 1072591493 10:96832267-96832289 GCCGCGGCGGAGGCTGGGCCGGG 0: 1
1: 1
2: 9
3: 123
4: 1241
1072591482_1072591493 6 Left 1072591482 10:96832238-96832260 CCCGGGCGACGCGGCTGGGCGTG No data
Right 1072591493 10:96832267-96832289 GCCGCGGCGGAGGCTGGGCCGGG 0: 1
1: 1
2: 9
3: 123
4: 1241
1072591475_1072591493 25 Left 1072591475 10:96832219-96832241 CCGCGGGTGCGTGCGCGGCCCCG No data
Right 1072591493 10:96832267-96832289 GCCGCGGCGGAGGCTGGGCCGGG 0: 1
1: 1
2: 9
3: 123
4: 1241

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1072591493 Original CRISPR GCCGCGGCGGAGGCTGGGCC GGG Intronic