ID: 1072591496

View in Genome Browser
Species Human (GRCh38)
Location 10:96832271-96832293
Sequence CGGCGGAGGCTGGGCCGGGC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1126
Summary {0: 1, 1: 1, 2: 23, 3: 152, 4: 949}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1072591482_1072591496 10 Left 1072591482 10:96832238-96832260 CCCGGGCGACGCGGCTGGGCGTG No data
Right 1072591496 10:96832271-96832293 CGGCGGAGGCTGGGCCGGGCGGG 0: 1
1: 1
2: 23
3: 152
4: 949
1072591475_1072591496 29 Left 1072591475 10:96832219-96832241 CCGCGGGTGCGTGCGCGGCCCCG No data
Right 1072591496 10:96832271-96832293 CGGCGGAGGCTGGGCCGGGCGGG 0: 1
1: 1
2: 23
3: 152
4: 949
1072591483_1072591496 9 Left 1072591483 10:96832239-96832261 CCGGGCGACGCGGCTGGGCGTGC No data
Right 1072591496 10:96832271-96832293 CGGCGGAGGCTGGGCCGGGCGGG 0: 1
1: 1
2: 23
3: 152
4: 949
1072591481_1072591496 11 Left 1072591481 10:96832237-96832259 CCCCGGGCGACGCGGCTGGGCGT No data
Right 1072591496 10:96832271-96832293 CGGCGGAGGCTGGGCCGGGCGGG 0: 1
1: 1
2: 23
3: 152
4: 949

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1072591496 Original CRISPR CGGCGGAGGCTGGGCCGGGC GGG Intronic