ID: 1072591728

View in Genome Browser
Species Human (GRCh38)
Location 10:96833070-96833092
Sequence CCTCAGCGGGCGGCGGTGGC CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 318
Summary {0: 1, 1: 0, 2: 2, 3: 23, 4: 292}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1072591714_1072591728 19 Left 1072591714 10:96833028-96833050 CCAAGTGGGGTGTCATGGCCGCG 0: 1
1: 0
2: 0
3: 2
4: 38
Right 1072591728 10:96833070-96833092 CCTCAGCGGGCGGCGGTGGCCGG 0: 1
1: 0
2: 2
3: 23
4: 292
1072591711_1072591728 29 Left 1072591711 10:96833018-96833040 CCTGACCGAGCCAAGTGGGGTGT 0: 1
1: 0
2: 0
3: 3
4: 50
Right 1072591728 10:96833070-96833092 CCTCAGCGGGCGGCGGTGGCCGG 0: 1
1: 0
2: 2
3: 23
4: 292
1072591712_1072591728 24 Left 1072591712 10:96833023-96833045 CCGAGCCAAGTGGGGTGTCATGG 0: 1
1: 0
2: 0
3: 12
4: 110
Right 1072591728 10:96833070-96833092 CCTCAGCGGGCGGCGGTGGCCGG 0: 1
1: 0
2: 2
3: 23
4: 292
1072591721_1072591728 1 Left 1072591721 10:96833046-96833068 CCGCGGGGGGCAGCGGCTGCACT 0: 1
1: 0
2: 3
3: 92
4: 848
Right 1072591728 10:96833070-96833092 CCTCAGCGGGCGGCGGTGGCCGG 0: 1
1: 0
2: 2
3: 23
4: 292

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1072591728 Original CRISPR CCTCAGCGGGCGGCGGTGGC CGG Exonic
900119942 1:1044278-1044300 TCTCGGCGGGCGGCGGGGACGGG + Intronic
900467022 1:2830862-2830884 CAGCAGCAGGCGGCGGGGGCGGG - Intergenic
900542766 1:3212365-3212387 CCTGAGTGGGCGGTGGGGGCAGG + Intronic
901067768 1:6502549-6502571 CCTCAGCCGGAGGAAGTGGCCGG - Intronic
901791206 1:11654554-11654576 CCTCAGCGGACCGAGGAGGCTGG + Exonic
901961318 1:12828583-12828605 CCTCAGAGGGAGGCGGCGGAAGG + Exonic
901967910 1:12883188-12883210 CCTCAGAGGGAGGCGGCGGAAGG + Exonic
901975714 1:12942318-12942340 CCTCAGAGGGAGGCGGCGGAAGG + Exonic
901983308 1:13053453-13053475 CCTCAGAGGGAGGCGGCGGAAGG + Intronic
901985702 1:13073878-13073900 CCTCAGAGGGAGGCGGCGGAAGG - Exonic
901996107 1:13152889-13152911 CCTCAGAGGGAGGCGGCGGAAGG + Intergenic
901998780 1:13175465-13175487 CCTCAGAGGGAGGCGGCGGAAGG - Intergenic
902009460 1:13259447-13259469 CCTCAGAGGGAGGCGGCGGAAGG - Exonic
902017266 1:13318592-13318614 CCTCAGAGGGAGGCGGCGGAAGG - Exonic
902451336 1:16498854-16498876 GCTCCGCGGGCGGCCGTGGGAGG - Intergenic
902501534 1:16914428-16914450 GCTCCGCGGGCGGCCGTGGGAGG + Intronic
902690582 1:18108100-18108122 CGGGAGCTGGCGGCGGTGGCGGG - Exonic
903224851 1:21888686-21888708 CCACAGCGGCCGGCGGGGGTGGG + Intronic
903883720 1:26529630-26529652 CCTCGGGGCGCGGCGGGGGCGGG + Intergenic
903889250 1:26558689-26558711 CCTCAGGGGCTGGCCGTGGCGGG - Intronic
903893041 1:26582938-26582960 CCACAGCGGGCGGGGGTGGTGGG - Intergenic
903925139 1:26826635-26826657 CCGCGGCGGGCGGTGGCGGCGGG + Intergenic
904840967 1:33371538-33371560 TCTCTGTGGGGGGCGGTGGCTGG - Intronic
905142457 1:35858882-35858904 ACTCAGCAGGCTGAGGTGGCAGG - Intergenic
905202442 1:36323521-36323543 CCCGAGCGGGCGGGGGCGGCCGG - Intronic
907082881 1:51640890-51640912 ACTCAGGGGGCTGCGGTGGAAGG - Intronic
912447939 1:109751752-109751774 CCACAGCAAGCGGTGGTGGCTGG - Exonic
912514550 1:110210024-110210046 TGTCAGCGGGCTGCGGTGGGAGG + Intergenic
912879096 1:113390879-113390901 CCCCAGCGGGCTGTGGTCGCGGG + Intronic
914346120 1:146799743-146799765 CCTCTTCTGGCGGAGGTGGCAGG - Intergenic
914882565 1:151558931-151558953 ACTCAGCTGGCTGTGGTGGCAGG - Intronic
915322427 1:155063109-155063131 CCTCAGGTGGCGGCGGCGGAGGG - Intergenic
915463190 1:156081737-156081759 GCGCCGCGGGCGGCGGCGGCGGG + Exonic
916139910 1:161687309-161687331 CCTTAGCCGGGCGCGGTGGCGGG + Intergenic
917519605 1:175736910-175736932 CCTCAGGGGGCTGAGGTGGAGGG + Intronic
918010717 1:180584070-180584092 AGTCAGCGGGGCGCGGTGGCGGG + Intergenic
919820167 1:201467718-201467740 CCTCAGTGGGCCGCCTTGGCTGG - Intronic
920184606 1:204152121-204152143 CCTCAGCTGCCGGCGGTGGCTGG - Intergenic
921060230 1:211578900-211578922 ACCCAGGCGGCGGCGGTGGCGGG + Intergenic
922505052 1:226121549-226121571 CCGCAGGGGCCGGGGGTGGCGGG + Intergenic
922845978 1:228684435-228684457 ACTCAGGGGGCTGCGGTGGAAGG - Intergenic
923123347 1:231014401-231014423 ACTCAGGGGGCTGCGGTGGGAGG - Intergenic
924439073 1:244071593-244071615 ACTCAGCGGGCTGAGGTGGGAGG + Intergenic
1063440919 10:6072227-6072249 ACTCAGCAGGCTGAGGTGGCAGG + Intergenic
1064086640 10:12350178-12350200 GCGGAGAGGGCGGCGGTGGCAGG - Intronic
1064684477 10:17845604-17845626 CCTGAGTGTGCGGCGGTGTCTGG + Intronic
1065099937 10:22322001-22322023 GCTGAGCGGGCGGCGGCGGCTGG - Intronic
1070032614 10:72692192-72692214 CCTCTCGGGGCGGCGGCGGCGGG + Exonic
1070145822 10:73772650-73772672 CCTCAGCGCTCGGCGGTTCCGGG - Exonic
1072410056 10:95193675-95193697 CCTCAGCGGGGGGCGGTGGGAGG - Intergenic
1072412945 10:95221507-95221529 ACTCAGCAGGCGGGGGTTGCAGG + Intronic
1072591728 10:96833070-96833092 CCTCAGCGGGCGGCGGTGGCCGG + Exonic
1074618681 10:115094166-115094188 CCTCAGCGCGCGGCGGGAGCGGG + Intronic
1075728011 10:124620513-124620535 CCCCAGCTGGGGGCAGTGGCAGG - Exonic
1075865973 10:125719615-125719637 CCGCAGCGGGAGGCGGGGCCGGG + Exonic
1076795170 10:132794758-132794780 CCTCACCGGGGGGGGGTGGGGGG + Intergenic
1076908119 10:133373286-133373308 CCTCAGCGGGCCGCGGACGCAGG + Exonic
1077048192 11:555355-555377 CCTCTGCGGGAGGCGACGGCAGG + Exonic
1077322240 11:1947590-1947612 CCCCAGGGGGCGGGCGTGGCCGG + Intronic
1077412394 11:2409769-2409791 TCTCAGTGGGCGGCCGGGGCTGG + Intronic
1077468511 11:2745675-2745697 CCTCAGCACCCGGCGGAGGCAGG + Intronic
1078612314 11:12831297-12831319 CCTCAGCTGGCAGAGGGGGCAGG - Intronic
1078774448 11:14381441-14381463 CCGCAGCGGGCGGGGCGGGCGGG - Intergenic
1079251509 11:18791207-18791229 CCTCTGCGGCCGGCGGAGGCTGG - Intronic
1081857464 11:46312735-46312757 CCTCAGGGGGCAGCAGAGGCAGG + Intronic
1083405887 11:62456782-62456804 ACTCAGCCGTAGGCGGTGGCAGG - Intronic
1083741474 11:64713723-64713745 CCTGAGCGGGGGCCGGGGGCCGG - Exonic
1083834931 11:65260480-65260502 AATTAGCGGGCGGTGGTGGCGGG - Intergenic
1083899804 11:65638145-65638167 CCAGCGCGGGCGGCGGCGGCTGG + Intronic
1084328402 11:68415050-68415072 CGTCAGCGGGCTACAGTGGCTGG - Intronic
1084357512 11:68650019-68650041 CCAAACAGGGCGGCGGTGGCTGG - Intergenic
1085012383 11:73150221-73150243 ACTCAGCAGGCTGCGGTGGGAGG - Intergenic
1085496810 11:76978000-76978022 CCAGAGGGGGCGGAGGTGGCAGG - Intronic
1086064562 11:82732559-82732581 CCTGATGGGGCGGCGGCGGCGGG + Exonic
1086634623 11:89066017-89066039 CCGCAGCGCGCGGCGGGGGTTGG + Intergenic
1089432650 11:118436556-118436578 CCACCGGGGGCGGCGGCGGCGGG + Exonic
1090194054 11:124800111-124800133 CCCCTGGTGGCGGCGGTGGCGGG - Exonic
1090662215 11:128890663-128890685 CCCCGGCGTGCGGCGGCGGCTGG - Intergenic
1090800998 11:130172221-130172243 ACTCAGCGGGCTGAGGTGGGAGG - Intronic
1090963743 11:131580414-131580436 CCTCAGAGGGCAGGTGTGGCAGG - Intronic
1091286824 11:134412443-134412465 CCTCCGCGGGGGACGGTGCCGGG - Intergenic
1202805258 11_KI270721v1_random:2903-2925 CCCCAGGGGGCGGGCGTGGCCGG + Intergenic
1094460872 12:30695765-30695787 CCGCAGGTGGCGACGGTGGCGGG - Exonic
1095752723 12:45729422-45729444 CCTCAGCCGGCGGCGCTGAGAGG + Intergenic
1097863829 12:64543231-64543253 CCTGGGCGGGCGGCGCCGGCCGG - Intergenic
1103698518 12:122835528-122835550 CAAAAGCGGGCGGCGGCGGCAGG + Exonic
1104444639 12:128823486-128823508 CAGCAGCGGGCGGCGGCGTCGGG + Exonic
1104920129 12:132286208-132286230 CCTCGGCGGGCGTCGGGGGATGG + Intronic
1106078633 13:26482356-26482378 CCTCAGCTGGAGGCAGTAGCTGG - Intergenic
1106208389 13:27620437-27620459 CCTCAGCGGGCCGCGGAGAGCGG - Intergenic
1108183266 13:47863421-47863443 CCTCAGCCGGGCGCGGTGGCTGG + Intergenic
1112099306 13:96169587-96169609 ACTCAGAGGGCTGAGGTGGCAGG + Intronic
1113654471 13:112059128-112059150 CCCCATCGGGCGGCAGTGGAGGG - Intergenic
1113656833 13:112072816-112072838 CCCCTCCGGGCGGGGGTGGCCGG + Intergenic
1113857205 13:113453814-113453836 CCGCAGCGGGCGGCAGTGACAGG - Intergenic
1113873911 13:113582997-113583019 CCACAGCAGGCGGCAGAGGCTGG - Intergenic
1114598661 14:23935791-23935813 ACTCAGCGGGCTGAGGAGGCAGG - Intergenic
1115290091 14:31760938-31760960 ACTCAGCAGGCTGCGGTGGGAGG - Intronic
1115901666 14:38158038-38158060 TCTCAGTGGGGGGCGGTGGTGGG - Intergenic
1119326119 14:73760388-73760410 CCTCAGGCGGCGGCCGGGGCTGG + Intronic
1121546915 14:94769621-94769643 CCGCAGTGGGCGGCAGAGGCCGG + Intronic
1122691458 14:103533775-103533797 CCCCAGCGGGCTCCCGTGGCCGG - Intronic
1123480692 15:20628745-20628767 CCTCGGGCGGCGGCGGGGGCCGG + Intergenic
1123637317 15:22371622-22371644 CCTCGGGCGGCGGCGGGGGCCGG - Intergenic
1124371114 15:29105299-29105321 CCTCAGCAGGGGGCTGCGGCAGG - Intronic
1125653487 15:41337123-41337145 ACTCAGGGGGCTGCGGTGGGAGG - Intronic
1128056396 15:64702933-64702955 CCGCTGCGGGGGGCGGGGGCCGG + Intronic
1128179500 15:65589264-65589286 ACTCAGGGGGCGGAGGTGGAAGG - Intronic
1129540386 15:76342974-76342996 CCAGAGCGGGCGGCCGTGACGGG + Intergenic
1129737659 15:77975065-77975087 CCTCTGGGGGCAGCAGTGGCTGG - Intergenic
1130115609 15:81002118-81002140 CCTCTGCCCGCGGCGGTGGATGG + Exonic
1131156898 15:90081061-90081083 CCTCAGCAGGCTGGGGTGGGAGG + Exonic
1131692813 15:94845083-94845105 AAGCAGCGGGCGGCGGCGGCGGG - Intergenic
1131827191 15:96331226-96331248 CGACTGCGGGCGGCGGCGGCCGG + Exonic
1132365103 15:101251510-101251532 CCTCCGCGGGCGGGGGCAGCGGG - Exonic
1132884639 16:2177252-2177274 CCTCAGAGGGCGGCACAGGCTGG - Exonic
1133034758 16:3028511-3028533 CCTCAGGGAGCCGGGGTGGCGGG + Intronic
1133103573 16:3493529-3493551 CCTCTCAGGGAGGCGGTGGCGGG + Exonic
1137631848 16:49952143-49952165 AATCAGTGGGGGGCGGTGGCGGG + Intergenic
1139987859 16:70915524-70915546 CCTCTTCTGGCGGAGGTGGCAGG + Intronic
1141054641 16:80804086-80804108 CGGCGGCGGGCGGCGGCGGCGGG - Intronic
1141054645 16:80804096-80804118 AGTCAGCGGGCGGCGGCGGGCGG - Intronic
1141594466 16:85088813-85088835 TCTCAGCGTGGGGCTGTGGCTGG + Exonic
1141711074 16:85699265-85699287 CCTCAGCGGTCTGCCGTGGCTGG - Intronic
1141959187 16:87392815-87392837 CTTGCGGGGGCGGCGGTGGCCGG - Intronic
1142046121 16:87926376-87926398 ACTCAGAAGGCAGCGGTGGCTGG - Intronic
1142162852 16:88567968-88567990 ACCCAGGGGGCGGAGGTGGCAGG + Intergenic
1142698429 17:1645825-1645847 CCTGAGAGGGAGGGGGTGGCTGG + Intergenic
1143023677 17:3929180-3929202 CCACAGCTGGAGGTGGTGGCTGG + Intronic
1143548607 17:7614877-7614899 GCGCAGTAGGCGGCGGTGGCAGG - Intronic
1143850689 17:9809471-9809493 CCTGAGAGGGTGGCTGTGGCGGG + Intronic
1146281950 17:31550273-31550295 GCTCCGCGGTCGGCGGGGGCCGG + Intergenic
1147168720 17:38606117-38606139 CCGCAGCGCGCGGCCGGGGCCGG + Intergenic
1147557000 17:41486005-41486027 TCTGAGTGGGAGGCGGTGGCAGG - Intergenic
1147571136 17:41571861-41571883 CCTCAGGGGGCGGTGGAGGAGGG - Exonic
1147705732 17:42423457-42423479 CCTCCGCTGGCGGCGGGAGCGGG + Exonic
1149529044 17:57380324-57380346 CCACAGCGGGCGGCCTGGGCAGG + Intronic
1149884602 17:60327894-60327916 CCAAAGCGGGCTGAGGTGGCAGG - Intronic
1149987055 17:61355080-61355102 CCCCAGCTGGCGGAGGTGTCTGG - Intronic
1150295060 17:64003018-64003040 CATGAGCGGGCGGCGGGGTCTGG - Intronic
1151203562 17:72488029-72488051 CCTCTCCGGGCGGCTCTGGCAGG + Intergenic
1151729162 17:75900846-75900868 CCTCAGGAGGCAGAGGTGGCAGG + Intronic
1152375401 17:79916158-79916180 CCACAGCGGGCGTGGCTGGCAGG - Intergenic
1152379551 17:79935275-79935297 CCCCAGCAGGCGGCGATGGAGGG - Exonic
1152388205 17:79987681-79987703 CCGCAGAGGGAGGCTGTGGCTGG - Intronic
1152538085 17:80961762-80961784 CCTCCACGGGCAGGGGTGGCAGG + Intronic
1152655855 17:81518980-81519002 CCCCAGCGCGCCGCGGGGGCGGG + Intronic
1153480575 18:5543360-5543382 GCTCAGCGCGCGGCGGCAGCGGG - Intronic
1153636383 18:7117261-7117283 GCTGCGCGGGCGGGGGTGGCGGG - Intronic
1154163417 18:11996552-11996574 CCTCAGCGGGCGGGGTGGGCAGG - Intronic
1154172218 18:12060537-12060559 CCACTGCGGGGGGCGGTGGGGGG + Intergenic
1155442504 18:25876853-25876875 ACTGAGCGGGCGGGGATGGCAGG + Intergenic
1158256667 18:55558101-55558123 ACTCAGCAGGCGGCGGTAGGAGG + Intronic
1158967104 18:62632059-62632081 CCTCAGGAGGCTGAGGTGGCAGG + Intergenic
1160577247 18:79863684-79863706 GCTCCCCGGGCGGCGGCGGCGGG + Exonic
1160833390 19:1113530-1113552 CCCCAGCGGGTGGCGGAGGTGGG - Exonic
1160882053 19:1325364-1325386 CCGCGGCGGGGGGCGGCGGCCGG + Intergenic
1162372367 19:10287248-10287270 CCGCAGCGGGGTGCGGAGGCTGG - Exonic
1162379541 19:10323347-10323369 CCTGTGCGGGCAGAGGTGGCGGG - Intronic
1162808729 19:13151923-13151945 AGTCAGCGGGCGCTGGTGGCGGG + Intronic
1163084991 19:14973020-14973042 TCTCAGAAGGCGGGGGTGGCTGG + Intronic
1163127735 19:15253397-15253419 CCTCAGTGGGAGGTGGAGGCAGG - Intronic
1163240948 19:16063293-16063315 ACTCAGCGGGCTGAGGTGGGAGG + Intergenic
1163507961 19:17719497-17719519 CCGAAGATGGCGGCGGTGGCTGG + Exonic
1163577164 19:18117792-18117814 CGACCGCGGGCGGCGGGGGCGGG - Intronic
1163603415 19:18261736-18261758 CCTCAGTGGGCTGAGATGGCTGG + Intronic
1163651802 19:18522116-18522138 CGTCAGCGGGCGGCGGGGCGGGG - Exonic
1163782508 19:19257865-19257887 GCTGGGCGGGCGGCGGCGGCTGG - Exonic
1163830634 19:19545647-19545669 CCTCCGCGGGCACCGGTGGGGGG - Exonic
1164639145 19:29812040-29812062 GCCGAGCGCGCGGCGGTGGCGGG - Exonic
1165884457 19:39067800-39067822 CCTCAGCCGGGAGTGGTGGCGGG - Intergenic
1166151856 19:40880658-40880680 GGTCAGGGGGCGGCGGTGGCAGG + Intronic
1166718209 19:44982607-44982629 CCCCAGAGGGCAGCGCTGGCTGG - Intronic
1167072918 19:47230947-47230969 CCGGAGGGGGCGGCGGTGGGGGG + Intronic
1167330813 19:48854846-48854868 CCTTAGCTGGCACCGGTGGCTGG - Intronic
1167466168 19:49652006-49652028 CCGGGGCGGGCGGCGCTGGCTGG - Exonic
1167638633 19:50668527-50668549 CCACGGCGGGCGGCGGCTGCGGG + Exonic
1167730483 19:51250739-51250761 CCGCAGCTGGGGGCGGTGCCAGG - Intronic
1168322181 19:55517252-55517274 TCGCAGCGGGCCGCGGTGGCCGG - Exonic
925155934 2:1648969-1648991 CCGCAGCAGGCCGCGGTGGCTGG + Exonic
925318063 2:2940251-2940273 CCTGGGCGGGCGGCGTTGGGTGG + Intergenic
926284974 2:11481923-11481945 CCTGAGCGGTCGGCGGCGGTGGG + Intergenic
927472173 2:23385091-23385113 CCCGAGTGGGCGGGGGTGGCGGG - Intergenic
929459210 2:42089615-42089637 CCGCGGCGGGCGTTGGTGGCAGG - Intergenic
930529367 2:52571708-52571730 GCTAAGGGGGCGGCGGAGGCTGG - Intergenic
930648084 2:53933486-53933508 CCTCAGCAGGCTGAGGTGGGAGG - Intronic
930782124 2:55233156-55233178 CCAGAGCGGGCGGCGGCCGCAGG - Intronic
930798661 2:55419900-55419922 CATTGGCGGGCGGCGCTGGCGGG - Intronic
932780421 2:74555519-74555541 CCTCAGCGGGGAGCGGGGGTCGG - Intronic
936385416 2:112024453-112024475 CCACAGGAGGCGGGGGTGGCAGG - Intronic
936433261 2:112482222-112482244 CCGGCGCGGGCGGCGGGGGCCGG + Exonic
938343376 2:130549682-130549704 CCTCATCGGGCGGAGGGGGACGG + Intronic
938346457 2:130571040-130571062 CCTCATCGGGCGGAGGGGGACGG - Intronic
939229940 2:139411458-139411480 CCTCAGATGGCGGGGGTGGGAGG - Intergenic
941020926 2:160407532-160407554 TCGCTGCGGGCGGCGGCGGCGGG + Intronic
943767418 2:191677989-191678011 GCTCTGCGGGCTGCGGCGGCCGG + Intergenic
944538215 2:200732019-200732041 CCTCAGGGAGCGGCGATGGATGG + Intergenic
946403863 2:219482831-219482853 CCTCTCCCGGCGGAGGTGGCAGG + Exonic
948206390 2:236164690-236164712 CCTCAGTCGGAGGCGGAGGCTGG - Intergenic
948393465 2:237628003-237628025 GCGCAGCGGCCGACGGTGGCCGG - Intronic
948645321 2:239400691-239400713 CCGCGGCGGGCGGCGGCGGCCGG + Exonic
948823733 2:240564296-240564318 CCTCAGAGGGCACTGGTGGCAGG - Intronic
1169291762 20:4359052-4359074 CCTCAGCAGGCGGTGGGGGTGGG + Intergenic
1169405930 20:5321254-5321276 CCTCAGAGAGAGGCGGTGGTGGG + Intergenic
1171013749 20:21522390-21522412 CCGCGCCGGGCGGCTGTGGCAGG + Intergenic
1172019574 20:31904464-31904486 ACTCAGGGGGCCGAGGTGGCAGG - Intronic
1172295963 20:33811429-33811451 CCGGAGCGGGCGGCGAAGGCCGG + Exonic
1174286235 20:49475713-49475735 CCTCAGCGGGTACGGGTGGCGGG - Intronic
1175819320 20:61900104-61900126 CCTCAGCGGGGGGGACTGGCTGG + Intronic
1176062607 20:63178902-63178924 CCGCAGAGGGCGGCGGGGCCCGG + Intergenic
1176261906 20:64186265-64186287 ACCCAGAGGGCGGCGCTGGCTGG - Intronic
1180799586 22:18625571-18625593 CCTCAGAGGGCCACGGTAGCTGG + Intergenic
1181222130 22:21369695-21369717 CCTCAGAGGGCCACGGTAGCTGG - Intergenic
1181306801 22:21921629-21921651 CCTCACCTTGCCGCGGTGGCTGG - Exonic
1181637891 22:24182689-24182711 CCTCAGTGGGCCACGGTAGCTGG - Intronic
1181813764 22:25421360-25421382 CCGCAGGGGGCGGCGGCGTCGGG - Intergenic
1181831672 22:25564961-25564983 GCGCGGCGGGCGGCGGCGGCGGG + Exonic
1182122793 22:27798198-27798220 GCTCTGGTGGCGGCGGTGGCGGG - Exonic
1182619291 22:31609985-31610007 CCTTAGAGGGAGGCGGTGGCAGG + Intronic
1183102879 22:35594542-35594564 CCTCAGGGGTGGACGGTGGCAGG - Intergenic
1184648739 22:45910050-45910072 CCTCAGCTGGGGGTGGTGGCCGG - Intergenic
1185018551 22:48359744-48359766 CCTTAGGTTGCGGCGGTGGCGGG - Intergenic
1185179810 22:49352836-49352858 CCTCAGAGGGCGGCCCCGGCTGG - Intergenic
950066443 3:10115687-10115709 CCTCAGGCGGCGGCCATGGCGGG + Exonic
950461602 3:13125457-13125479 CCGGAGCAGGCGGTGGTGGCAGG + Intergenic
952299615 3:32092885-32092907 ACTCAGGGGGCTGAGGTGGCAGG - Intergenic
952962356 3:38600354-38600376 CCTGAGAGGGCTGAGGTGGCTGG + Intronic
954025724 3:47781771-47781793 CCGCAGCGGCGGGCGGCGGCGGG - Exonic
956468601 3:69542480-69542502 GCACGGCGAGCGGCGGTGGCGGG - Intronic
956520667 3:70100253-70100275 ACTCAGAGGGCTGAGGTGGCAGG - Intergenic
958901939 3:99897290-99897312 CCTCCGCGGGAGGAGGTTGCAGG + Intronic
960115085 3:113885266-113885288 CCTCCGGGGCCGGCGGTGCCGGG + Intronic
961812898 3:129531972-129531994 CCTCAGCGGGCAGTGGATGCTGG + Intronic
962032483 3:131615974-131615996 CCTCAGAAGGGGGCTGTGGCGGG - Intronic
966911474 3:184562459-184562481 CCGGAGCGGGCGCCGGTGGCGGG - Intronic
967493654 3:190120428-190120450 CCTCGCCGGGGGGCGGGGGCGGG + Exonic
968230585 3:197002881-197002903 CCTCTGCTGGCGGCGGCGGGAGG - Exonic
968487515 4:871035-871057 CTTCCGCAGGCGGGGGTGGCCGG - Intronic
968943973 4:3654025-3654047 CCTGAGCGGGCGGAGGTGGAGGG + Intergenic
969721716 4:8895833-8895855 CCTCCTCGGGCGGCTGTCGCAGG - Intergenic
970441454 4:16083801-16083823 CCTCCGCGGCCGGCAGTGGGAGG - Intronic
972772206 4:42208040-42208062 ACTCAGAAGGCGGAGGTGGCAGG + Intergenic
974278658 4:59760387-59760409 ACTCAGCAGGCGGAGGTTGCAGG - Intergenic
982668241 4:158291884-158291906 CCTCAGCAGGCTGGGGTGGGAGG - Intergenic
983957069 4:173710273-173710295 CCTCAGCAGGCTGAGGTGGGAGG - Intergenic
986330615 5:6713912-6713934 CCTCGGGGCGCGGCGGGGGCGGG + Intergenic
987874615 5:23664984-23665006 ACTCAGGGGGCTGAGGTGGCAGG - Intergenic
990042421 5:51390105-51390127 CCTCAGCTGGCGGCCGGCGCCGG - Intronic
990376217 5:55173345-55173367 CCTCGGCCGGAGGCGGTGGCGGG - Intergenic
996978453 5:129461337-129461359 CCTCCGACGGCGGCGGGGGCCGG - Exonic
999053688 5:148550954-148550976 CCTGAGCTGGGGGCTGTGGCAGG - Intronic
1000220469 5:159209320-159209342 CCTCGGGCGGCGGCGGGGGCCGG + Intronic
1002344432 5:178537517-178537539 CCTCAGAGGGAGTCTGTGGCAGG + Intronic
1002445213 5:179286445-179286467 GCTCAGGGGGCTGGGGTGGCAGG + Intronic
1002545849 5:179944651-179944673 CCTCAGGGGGCTGAGGTGGGAGG + Intronic
1002611444 5:180421134-180421156 ACTCAGCGGGAGGCTGAGGCAGG + Intergenic
1002723754 5:181281723-181281745 CCTGAGCGGTAGGCGGGGGCTGG + Intergenic
1002723779 5:181281801-181281823 CCTGAGCGGTAGGCGGGGGCTGG + Intergenic
1004274883 6:14227240-14227262 CCTCAGGGGGAAGCGGTGTCAGG - Intergenic
1006055000 6:31377691-31377713 CCTCAGCGGGAGGCTGCAGCAGG - Intergenic
1006599101 6:35214109-35214131 CCTCTGCCAGCGGCGGCGGCGGG - Intergenic
1006903282 6:37516576-37516598 TCTCAGCGGGCTGCAGAGGCAGG - Intergenic
1007673484 6:43575958-43575980 CCGCGGCGGGCGGCGGGGGTGGG + Exonic
1009899685 6:69796640-69796662 CTTGGGCGGGCGGCGGGGGCAGG - Intronic
1010001597 6:70955425-70955447 CCGTAGCGGGTGGCGGTGGAGGG - Intronic
1017493299 6:154962840-154962862 CCACAGTGGGAGGCGGGGGCTGG - Intronic
1017651710 6:156589346-156589368 CCTCAGTGGGTGGGGGTGGGGGG - Intergenic
1018427199 6:163694219-163694241 CCTCACAGGGAGGAGGTGGCTGG + Intergenic
1018911123 6:168101363-168101385 CCTCATCTGGTGGCGGCGGCTGG + Intergenic
1019475828 7:1243830-1243852 CCTCTCCTGGCGGCGGGGGCGGG + Intergenic
1020140097 7:5607182-5607204 CCTCAGGGGGCGGCCGTGGTAGG + Intergenic
1022794672 7:33722567-33722589 CCTCAGGGGATGGCGGAGGCTGG + Intergenic
1022989590 7:35694820-35694842 GCGCGGAGGGCGGCGGTGGCGGG - Exonic
1023918572 7:44608607-44608629 CCTCAGCAGGAGGCTGAGGCAGG + Intronic
1027138239 7:75639298-75639320 CCGCAGCGCGCGCCGGGGGCGGG + Intronic
1030176501 7:106660422-106660444 CCTCGGGGGGCGGCGGCGGTGGG + Exonic
1030176601 7:106660829-106660851 CCGCCCCGGGCGGCCGTGGCCGG + Exonic
1031928690 7:127662997-127663019 ACTCAGCGGGCTGAGGTGGGAGG - Intronic
1033278563 7:139990258-139990280 GCACAGCTGGCGGTGGTGGCTGG + Intronic
1033641743 7:143268361-143268383 CCTCAGTGGGAGGCTGAGGCAGG + Intronic
1034172330 7:149071899-149071921 CTGCTGCGGGAGGCGGTGGCTGG + Exonic
1034219300 7:149431745-149431767 CCTGGCCGGGCGGCGGCGGCGGG + Exonic
1034540498 7:151755091-151755113 CCTGAGCGGGGGTCGGGGGCTGG + Intronic
1037231552 8:16664741-16664763 CCTCAGGGGGCTGAGGTGGGAGG - Intergenic
1038569588 8:28649039-28649061 CCTTAGCTGGGAGCGGTGGCGGG - Intronic
1039864760 8:41490861-41490883 CCGCAGCAGGCGCCGGTGTCCGG + Exonic
1041690155 8:60679662-60679684 CCGGAGCGGGGGGCGGGGGCGGG - Intronic
1041693599 8:60714084-60714106 CCTCGGCGGGCGGGGTGGGCCGG + Intronic
1045327286 8:101126655-101126677 ACTCACCGGGCGGGGGCGGCTGG - Intergenic
1045509960 8:102806546-102806568 CCTCCGGGGGAGGCGGGGGCGGG - Intergenic
1045810170 8:106212145-106212167 ACTCAGTGGGCGGCTGAGGCAGG - Intergenic
1046547432 8:115669110-115669132 TCCCGGCGGGCGGCGGCGGCGGG - Intronic
1047454684 8:124998376-124998398 CCTCATTGGCCGGCGGCGGCAGG + Intergenic
1048359879 8:133688597-133688619 CCTCAGAGGGGGGCCATGGCAGG + Intergenic
1049562337 8:143317977-143317999 CCTCAGCAGTGGGCGGCGGCAGG - Intronic
1050100232 9:2111381-2111403 CCTCAGCAGGCTGAGGTGGGAGG + Intronic
1054775652 9:69121684-69121706 CCGCCGCGGCCGGCGGTGTCGGG - Intronic
1055030670 9:71769094-71769116 CCGCAGCGGGGGGCGCTGGCTGG - Intronic
1055774684 9:79754742-79754764 ACTCAGCAGGCGGAGGTTGCAGG - Intergenic
1056078168 9:83062624-83062646 CCTCCGCGGGGGGCGGCGCCGGG - Exonic
1057519993 9:95752479-95752501 CCTCAGCGGGTGGGGGGGTCAGG + Intergenic
1060600793 9:124876058-124876080 CCTCAGCGGGCGGCAGTCAGTGG + Intronic
1060770153 9:126326742-126326764 CCTCCGCGGGCCGCGGCGGCGGG - Intergenic
1061056257 9:128224497-128224519 CCTCAGCGGGGTGGGGAGGCAGG + Intronic
1061248602 9:129413992-129414014 CCTAAGCGGGCGGCAGGGGCAGG - Intergenic
1061285597 9:129620603-129620625 CCTCAGCGCGCGTGGGTGGGGGG + Exonic
1061495858 9:130973833-130973855 CCCCTGTGGGCGGTGGTGGCTGG + Intergenic
1061745885 9:132740132-132740154 CCTTAGGGGGCTGCTGTGGCAGG - Intronic
1062214531 9:135382126-135382148 CCTCAGCAGGGGGTGCTGGCGGG + Intergenic
1062342356 9:136099454-136099476 CCTCAGGGGTCGGGGGTGACAGG + Intergenic
1186471250 X:9823865-9823887 CCTCAGCAGGCTGAGGTGGGAGG - Intronic
1190192921 X:48292712-48292734 AATCAGCTGGCGGTGGTGGCAGG - Intergenic
1190286165 X:48962659-48962681 CCTCCCCTGGCGGCGGTGGCAGG - Exonic
1190297699 X:49038280-49038302 CCTCAGGGGCAGGCAGTGGCTGG + Exonic
1192624674 X:72714772-72714794 CCCCAGAAGGCGGCGTTGGCAGG + Intergenic
1195163731 X:102197021-102197043 CTGAAGCGGGCGGCGGGGGCGGG - Intergenic
1195551372 X:106175387-106175409 AATCAGCAGGGGGCGGTGGCTGG - Intronic
1198310214 X:135422462-135422484 CCGCGGCGGGGGGCGGAGGCGGG + Intergenic