ID: 1072598137

View in Genome Browser
Species Human (GRCh38)
Location 10:96895136-96895158
Sequence TAGGTGACTTTGAAGTTAAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 246
Summary {0: 1, 1: 0, 2: 2, 3: 19, 4: 224}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1072598137 Original CRISPR TAGGTGACTTTGAAGTTAAA AGG (reversed) Intronic
900854991 1:5173824-5173846 TAGGTGACTTTAACGGTACAAGG - Intergenic
903071704 1:20730076-20730098 GATGTGACTGTGAAGTTGAAAGG - Intronic
903588278 1:24434202-24434224 TTTGTGTCTTTGAATTTAAAGGG - Intronic
903606336 1:24577743-24577765 TAGGTGACTATGAAGTGACTCGG + Intronic
903908345 1:26702924-26702946 TATGAGACTTTGAGGTTTAAAGG + Intronic
908043900 1:60147460-60147482 TCGGTGACTTTAAAATAAAAAGG + Intergenic
908336196 1:63126380-63126402 TATTTGTCTTTGAAGTTAAATGG - Intergenic
909319747 1:74269120-74269142 GAGGTGACTTTTGAGATAAATGG - Intronic
909938612 1:81584309-81584331 TAGAGGACTTGGAACTTAAATGG + Intronic
911115358 1:94240378-94240400 TAGTTTACTTTTAATTTAAAAGG + Intronic
911792082 1:102030121-102030143 TGGCTGACTTTGAAGATAAAAGG + Intergenic
911860313 1:102939281-102939303 TAGTATACTTTGAAGTTAAACGG - Intronic
915335459 1:155138394-155138416 GAGATGACTTTGAGGATAAAAGG + Exonic
916793180 1:168142088-168142110 TTGCTGACTTTGAAGATAAGGGG - Intergenic
917258805 1:173145226-173145248 TGGGTAAATATGAAGTTAAAAGG - Intergenic
918089064 1:181272132-181272154 AAGGTGACCTTGAAAATAAAGGG + Intergenic
918585238 1:186179630-186179652 TAGTGGGCTTTGAATTTAAACGG - Intronic
919225256 1:194690174-194690196 TAGGTGACTTTGATGTGATGTGG - Intergenic
923026497 1:230208758-230208780 TATGCGACTGTGAAGCTAAAAGG + Intronic
1064079610 10:12297983-12298005 AAGGGGAATTTGATGTTAAAGGG - Intergenic
1065412687 10:25447008-25447030 AAAGTGACTTACAAGTTAAAAGG + Intronic
1066002052 10:31113925-31113947 TAGGTGCCTCTGAAGTCAATGGG + Intergenic
1066631077 10:37460038-37460060 AAGGGGAATTTGATGTTAAAGGG - Intergenic
1068317857 10:55370760-55370782 GAGGTGAGTTTGAAGATAATCGG - Intronic
1068599973 10:58946519-58946541 TGGGTGGCTTTGAAGATGAAAGG - Intergenic
1069333539 10:67321732-67321754 TATGTGAGTTTGAATTTAAGAGG - Intronic
1071102601 10:82056388-82056410 TAGGAATCTTTGAAGCTAAAAGG + Intronic
1072340190 10:94439764-94439786 AAGGTGAATTTGGAGTTAAGAGG + Intronic
1072500115 10:96007030-96007052 TATTTGACTTTGAAGTTCAGGGG + Intronic
1072598137 10:96895136-96895158 TAGGTGACTTTGAAGTTAAAAGG - Intronic
1073638163 10:105220591-105220613 GCAGTGACTTTGAAGGTAAAAGG + Intronic
1073785780 10:106888258-106888280 AAGGAGACTATGAAGTTAGAAGG - Intronic
1075515562 10:123105319-123105341 TTGGTGCATTTGAAGTTAAAAGG - Intergenic
1076989043 11:259955-259977 TCGGTGACCTTGAAGGTAACTGG + Intergenic
1078132690 11:8625638-8625660 GAGGGGAATTTGAAGTTAGAGGG - Intronic
1080418894 11:32092931-32092953 GAGGTGACTTTGAAGTTCAAAGG - Intronic
1083429213 11:62605250-62605272 TAAGTGGCTTTGAAGTTAGGAGG - Intronic
1084178837 11:67436778-67436800 TAGGTGACATGGAAGGAAAAAGG - Intronic
1085787408 11:79466391-79466413 TAGAAAACATTGAAGTTAAATGG - Intergenic
1085806621 11:79642747-79642769 CAGGATGCTTTGAAGTTAAAAGG - Intergenic
1085819335 11:79775252-79775274 TAGGTTACTGTGAAGATGAAAGG + Intergenic
1086207107 11:84272210-84272232 TAAGTGATTTCGAAGTTACAGGG + Intronic
1089414340 11:118274533-118274555 CAGTTAACTTTGAAGGTAAAAGG + Intergenic
1090646344 11:128769397-128769419 TAGTTGCCTCTGAAGTCAAAAGG + Intronic
1091136681 11:133197396-133197418 TAGAGGACTTTGAAATGAAAAGG - Intronic
1095337756 12:41049170-41049192 TGGGAGACTTTAAAGTTCAAAGG - Intronic
1095410606 12:41917039-41917061 AAGGTGACTTTGACTTCAAAGGG - Intergenic
1095508711 12:42926152-42926174 GAGGAAACTTTGAAGTCAAACGG + Intergenic
1095607084 12:44080996-44081018 TAAGTGTTTTTGTAGTTAAATGG + Intronic
1101574303 12:105983266-105983288 TACCTGACTTTGATGTCAAATGG + Intergenic
1101673510 12:106897755-106897777 TGAGTGATTTTGAAGATAAATGG - Intergenic
1102664567 12:114560066-114560088 TAGATGAGTTTGAAGAGAAATGG + Intergenic
1103372377 12:120429519-120429541 CAGGCGACTTAGAAGTTAATGGG + Intergenic
1103974211 12:124691598-124691620 TAGGTGACTATGAGGATTAAAGG - Intergenic
1104226484 12:126839382-126839404 TAGGAGCCTTTTAAGATAAAGGG - Intergenic
1104321595 12:127756607-127756629 TGGGTGACTTTGAATTGAATGGG - Intergenic
1105236628 13:18562086-18562108 TAGGTAAATTTGAATTTATAAGG - Intergenic
1108083963 13:46765285-46765307 CGGGTCACTTTGAAGTTCAATGG + Intergenic
1108580472 13:51823940-51823962 TAGGTGAATTTGTTATTAAATGG + Intergenic
1108692719 13:52874073-52874095 TAGGTGATTTTGAAGTTGTCAGG + Intergenic
1108823656 13:54385272-54385294 TATGTGAGTTTGAAGCTCAAAGG + Intergenic
1112791825 13:103011313-103011335 CAGGTTATTTTGAAGTTAAAAGG + Intergenic
1116381445 14:44274040-44274062 TATGGGACTTTGAGATTAAATGG + Intergenic
1116388131 14:44358268-44358290 TAGGGGACTGTGCAGTGAAATGG + Intergenic
1116770498 14:49121964-49121986 TGTGTGACTTTCAAGTTAGAAGG + Intergenic
1117410188 14:55443392-55443414 TTGCTGGCTTTGAAGATAAATGG + Intronic
1119001604 14:70886945-70886967 TTGCTGACTATGAAGATAAAAGG - Intergenic
1119982019 14:79092600-79092622 TATTTGACTTTGAATTTAAATGG - Intronic
1120452472 14:84685660-84685682 TTAGTGACTTTGAATATAAATGG + Intergenic
1121421130 14:93815617-93815639 TAGGTGTCTTTATAGTTAAATGG - Intergenic
1121593787 14:95142528-95142550 TGGGTGACATTGAATTTTAAAGG - Intronic
1123204920 14:106703119-106703141 TATGTGACTTGGAAGTTGCAGGG - Intergenic
1123209922 14:106749560-106749582 TATGTGACTTGGAAGTTGCAGGG - Intergenic
1125034620 15:35109827-35109849 TTGGTGACTTTAAATTTATACGG - Intergenic
1125581763 15:40790837-40790859 TAGGTGCCTGTTAAGTCAAAAGG - Intronic
1126623454 15:50663515-50663537 TAGGTCACTTGGGATTTAAATGG - Intronic
1128364086 15:66984704-66984726 TAGGTGATTTTGAAAATTAAAGG + Intergenic
1128801808 15:70501794-70501816 CAGGTGACATTGAGGTAAAATGG - Intergenic
1129117355 15:73371936-73371958 TAGGGGACTTTGGAGACAAATGG + Intergenic
1129703783 15:77783062-77783084 GAGGTGACTTTGAGGCTGAAGGG - Intronic
1135316007 16:21444828-21444850 TAGGAGACTTTTTAGTTAGAGGG + Intronic
1135368932 16:21877090-21877112 TAGGAGACTTTTTAGTTAGAGGG + Intronic
1135442884 16:22494053-22494075 TAGGAGACTTTTTAGTTAGAGGG - Intronic
1136169634 16:28480932-28480954 TTGGTGACTTTGAAGTCAGTGGG - Intronic
1136312683 16:29423564-29423586 TAGGAGACTTTTTAGTTAGAGGG + Intergenic
1136326117 16:29525313-29525335 TAGGAGACTTTTTAGTTAGAGGG + Intergenic
1136440806 16:30265297-30265319 TAGGAGACTTTTTAGTTAGAGGG + Intergenic
1138825183 16:60310101-60310123 TTGGTGACTTTAAAGATAGAAGG + Intergenic
1139416905 16:66819980-66820002 TGGGTCACTTTGAAGTTGAGTGG - Intronic
1139887322 16:70217614-70217636 TAGGAGACTTTTTAGTTAGAGGG + Intergenic
1143555352 17:7656412-7656434 TTGGTGACTTTGAATTTATCTGG + Exonic
1150577287 17:66441447-66441469 AAGCAGACTTTGAAGTGAAAGGG - Intronic
1153363926 18:4232050-4232072 GAGGTGAGCTTGAAGTTTAAAGG + Intronic
1154512907 18:15127826-15127848 TAGGTAAATTTGAATTTATAAGG + Intergenic
1157019999 18:43769646-43769668 TAAGTGATTTTGGAGATAAATGG + Intergenic
1158075579 18:53524628-53524650 TAACTGACTTGGAATTTAAAGGG - Intronic
1158822549 18:61178171-61178193 GAAGTGACTTTGAAGGTAACAGG + Intergenic
1158914293 18:62105704-62105726 TATATGACTGTGAAGGTAAAAGG + Intronic
1159989491 18:74886746-74886768 CAGGGAACCTTGAAGTTAAAAGG + Intronic
1160354981 18:78219960-78219982 CTGGTGACCTTGGAGTTAAAAGG - Intergenic
1164812169 19:31165759-31165781 TAGGTCACTTTAAATTTACACGG - Intergenic
925834587 2:7931782-7931804 AAGGTGAGTTTGTAGTTTAAGGG + Intergenic
928307020 2:30178651-30178673 TGGGTGGCTTTGAAGTCAAAGGG + Intergenic
928498959 2:31866947-31866969 TGGGCGACTTTGAATCTAAAAGG + Exonic
928933021 2:36645150-36645172 AAGGTGGTTTTAAAGTTAAAGGG + Intronic
933047349 2:77556037-77556059 TAGTTTACTTTCAAGATAAATGG + Intronic
933858266 2:86440470-86440492 AAGGTGACTTTGAAGGACAAAGG - Intergenic
935303280 2:101712847-101712869 TAGTTCACTTTGAACTTCAAGGG + Intronic
936572073 2:113625811-113625833 TAGGTGACTTGGAATAGAAAGGG - Intergenic
938339992 2:130529461-130529483 AAGGAGAATTTGAAGATAAAAGG + Intergenic
938349843 2:130591287-130591309 AAGGAGAATTTGAAGATAAAAGG - Intergenic
938513161 2:131972465-131972487 TAGGTAAATTTGAATTTATAAGG + Intergenic
938681798 2:133699719-133699741 TTGCTGACTTTGAAGTTGGAAGG - Intergenic
940337191 2:152541711-152541733 TAGGTGACATTAAACTTTAATGG - Intronic
941212989 2:162666441-162666463 TAGATGAGTTTGAAGATAGAAGG - Intronic
941333082 2:164204639-164204661 TTAGCAACTTTGAAGTTAAATGG + Intergenic
942003201 2:171671393-171671415 TTGCTGACTTTGAAGATAGAAGG + Intergenic
942677911 2:178448280-178448302 TATGGGAGTTTGAACTTAAAAGG - Intronic
944061296 2:195571687-195571709 GAGTTGAGATTGAAGTTAAAAGG - Intergenic
944707728 2:202308247-202308269 TAGGAGATTTTAGAGTTAAAAGG + Intergenic
945586025 2:211664061-211664083 AAGGTGAATTTGAATTTGAATGG + Intronic
946438863 2:219678427-219678449 TAGGTGTCTTTGAACTTAGATGG - Intergenic
1169781115 20:9311686-9311708 TAGGAGAGTTTGAGGTGAAAGGG - Intronic
1170500390 20:16969787-16969809 CAGGACACTTTGAAGTTTAAAGG - Intergenic
1170870551 20:20202004-20202026 TAGGTGACTTTGAGGTGAGTTGG + Intronic
1173072289 20:39779971-39779993 TAGTTTACTTTGAAGATAATTGG - Intergenic
1174510772 20:51050690-51050712 CAGAAGACTTTGAAGTTAGAAGG + Intergenic
1175035678 20:55998735-55998757 TAGGTTAACTTGATGTTAAATGG - Exonic
1177978296 21:27879489-27879511 TAGGTAAATTTGAATTTATAAGG - Intergenic
1177981297 21:27917926-27917948 TAAGTAACTTTGAAAATAAATGG - Intergenic
1178255587 21:31049502-31049524 TAAGTAGCTTTGAATTTAAAGGG - Intergenic
1179497896 21:41785867-41785889 CAGGTGTAATTGAAGTTAAATGG + Intergenic
1185428118 22:50785069-50785091 TAGGTGACTTGGAATAGAAAGGG + Intergenic
951392343 3:22121898-22121920 TATGTGTCTTAGAAGTTCAAGGG + Intronic
954563620 3:51579642-51579664 TAGTTGACTTAGTAATTAAATGG - Intronic
954954426 3:54506785-54506807 TCGGAGACTTTGAAGATGAATGG + Intronic
955309631 3:57872707-57872729 TTTGTGACTTTCAAGTAAAAAGG - Intronic
955695047 3:61627530-61627552 TAGATTACTTTGAGGTAAAAAGG - Intronic
955926418 3:64009831-64009853 AAGGTGACATTTAAGTGAAAAGG - Intergenic
956510041 3:69983398-69983420 TAGCTGAATTTGAATTTAAAAGG + Intergenic
957360157 3:79145171-79145193 TAGGTAACTTTGCATTTACAAGG + Intronic
957366627 3:79232949-79232971 CAGTTGACTTTGATGTTATAAGG + Intronic
957875615 3:86142120-86142142 CAGGTGAAAGTGAAGTTAAAAGG + Intergenic
958018328 3:87968547-87968569 GAGGTGACTTAAATGTTAAAAGG + Intergenic
960275454 3:115724100-115724122 TAAGTCTCTTTGAAGATAAAAGG + Intergenic
962146715 3:132847336-132847358 TAGGTGCCTTTGAATTTAAAGGG + Intergenic
963359137 3:144248223-144248245 TAGCTGAGTTTGAAGTCACATGG - Intergenic
964526837 3:157623725-157623747 TAGCTGACTTGGTATTTAAAAGG + Intronic
964615594 3:158660981-158661003 TAAGTAGCTTTGAAATTAAATGG - Intronic
966481951 3:180419482-180419504 TATGTCTGTTTGAAGTTAAAAGG + Intergenic
966949241 3:184801203-184801225 TGGGTAACTGTGAAGTTAATGGG - Intergenic
967477453 3:189938165-189938187 GAGGTGACTTTGTCTTTAAATGG + Intergenic
968807228 4:2782299-2782321 GGGGTGACTTTGAATTTAACAGG + Intergenic
970689540 4:18606819-18606841 GAGGTGACTTGGAATTTTAAAGG + Intergenic
972567783 4:40284825-40284847 CAGGTGACGGTGAAATTAAAAGG + Intergenic
972858970 4:43143559-43143581 TAGGTGCCTTTAAAGTTGAGTGG - Intergenic
973101628 4:46279109-46279131 TAGCTGACTATGAAGTTTATGGG - Intronic
974157061 4:58087386-58087408 TAATTGACTTAGAAGATAAATGG + Intergenic
974617370 4:64307047-64307069 TAGGTGTCTTTGAAAATATAGGG - Intronic
974993718 4:69126959-69126981 TAACTTACTTTGAAGGTAAATGG - Intronic
975228807 4:71907111-71907133 TAGGTGAGTTTTATCTTAAAAGG - Intergenic
977374342 4:96182133-96182155 TAGCTGACTTTGAAGATGGAGGG + Intergenic
977692193 4:99925931-99925953 TAGGTCACTTTGAAGTCTGAAGG - Intronic
979338748 4:119494358-119494380 TAGGGGACTCTGAATTTTAAGGG - Intergenic
980108551 4:128612343-128612365 TATGTAAATTTGTAGTTAAAAGG + Intergenic
981472843 4:145156745-145156767 TATGTGACAGTGAATTTAAAGGG - Intronic
982356151 4:154471445-154471467 TAGCTGACCTTGAAAATAAAGGG - Intronic
982974455 4:162036178-162036200 TAAGTGAGTCTGAAGTTCAATGG - Intronic
984181784 4:176492158-176492180 TAGGTATCTTTGAAGTAGAAAGG - Intergenic
984512068 4:180691769-180691791 CAAGTCACTTTGTAGTTAAATGG + Intergenic
985142094 4:186851272-186851294 TAGGTGAATTTGAACTTCAATGG + Intergenic
987119269 5:14751204-14751226 CAGGTGACTGTGAAGCAAAATGG + Exonic
987582643 5:19814807-19814829 GAGGTGACTTTGATGCTAGAGGG - Intronic
988206620 5:28144412-28144434 AAGGTGACACTGAAGTTAAATGG - Intergenic
988782490 5:34535467-34535489 TAGATGACTTTGATCTGAAAGGG + Intergenic
990350066 5:54907224-54907246 TAAGTGTCTTTTAAGTTGAATGG - Intergenic
990723031 5:58719789-58719811 TAGGTCACTTTGGATTAAAATGG - Intronic
991259924 5:64655804-64655826 TTGCTGACTTTGAAGGTAGAGGG - Intergenic
993020853 5:82588844-82588866 TTGGTTAATTTGAATTTAAATGG + Intergenic
993649458 5:90501428-90501450 TAGTTGACTTTAAAGCTGAAAGG + Intronic
994542982 5:101123384-101123406 TAGGTAAATTTTAATTTAAATGG + Intergenic
995239001 5:109864597-109864619 TGTGTGACTTTTAAGTTAGATGG + Intronic
996254062 5:121376100-121376122 TATGTGAATTTAATGTTAAATGG + Intergenic
996496526 5:124163221-124163243 TAGGTGGGTTTGAAGGCAAAGGG + Intergenic
996579213 5:125011635-125011657 GAGGTAACTCTGAAGTTAAAAGG - Intergenic
996591369 5:125152034-125152056 TAGTTTACTTTGAAATTTAAAGG + Intergenic
998550582 5:143073866-143073888 TAGATGTCTTCGAAGTTAACGGG - Intronic
999963118 5:156778202-156778224 TAGGTGTCTTGTAATTTAAAAGG - Intergenic
1002382103 5:178838595-178838617 GAGGTGACTTTGAGTTTCAAAGG + Intergenic
1002484947 5:179528783-179528805 TAATTGACTTTGATGTTCAAGGG + Intergenic
1002648622 5:180674670-180674692 GAGGTGACTTTGAGTTTCAAAGG - Intergenic
1003930628 6:10920716-10920738 TAGGTAACTTTTAAGTTAATGGG + Intronic
1008303250 6:49869331-49869353 TAGGTGACTGTCAAGTTATAAGG - Intronic
1009979143 6:70705766-70705788 TTGGGGCCTTTGAAATTAAAGGG - Intronic
1010375954 6:75170543-75170565 AAGCCGACTTTGAAGTTGAATGG - Intronic
1012248030 6:96948094-96948116 TAGGTTACTTAGAAGTTACTGGG + Intronic
1012567501 6:100677123-100677145 GAAGTGCCTTTGAACTTAAATGG - Intronic
1013607780 6:111766304-111766326 GAGGTGAGCTTGAGGTTAAATGG - Intronic
1013690892 6:112641837-112641859 TAATTGATTTTGAGGTTAAATGG + Intergenic
1015631496 6:135236282-135236304 TGTGTGACTATGAAGTTTAAAGG + Intergenic
1015878500 6:137847515-137847537 TAAGTGAATGTGAAGGTAAATGG + Intergenic
1019169294 6:170122836-170122858 TTGATGACTTTGAAGATAAAGGG + Intergenic
1019869856 7:3750315-3750337 TAGTAGACTTCGAAATTAAATGG - Intronic
1020530000 7:9321510-9321532 GAGATGATTTTGAAGTAAAAAGG - Intergenic
1021546033 7:21813805-21813827 AAGCAGACTTTGAACTTAAAGGG + Intronic
1022158011 7:27679863-27679885 TACGGGACTTTGAAGTTCTAGGG + Intergenic
1023955364 7:44882811-44882833 TAGGTAACTTTGAATTGAATGGG - Exonic
1024232290 7:47371768-47371790 TAGGTGACTGTGAAGTAGAGTGG + Intronic
1026113577 7:67477674-67477696 TAGATGACTTTTAAGTTCAGGGG + Intergenic
1029242919 7:99177232-99177254 TTGGGGACTTTGTAGTTAACGGG + Intronic
1029904172 7:104073408-104073430 TAGATGACATTTAAGTAAAATGG + Intergenic
1031550984 7:123111244-123111266 TTGCTGGCTTTGAAGATAAAAGG - Intergenic
1033285405 7:140037001-140037023 TAGGCGACTTTGGAGTTGATGGG - Intronic
1036030685 8:4968447-4968469 TAGAGGTCTTTGCAGTTAAATGG - Intronic
1036282832 8:7416311-7416333 TAGGTGACTTTTTAAATAAAAGG - Intronic
1036338636 8:7895216-7895238 TAGGTGACTTTTTAAATAAAAGG + Intronic
1037137209 8:15477238-15477260 TAGTTGTCTATGAGGTTAAATGG + Intronic
1038515158 8:28181920-28181942 TAAGTGACTATAAAGTTAGAGGG - Intronic
1044789133 8:95828612-95828634 TAGGTGAGTTGGAAATTATATGG - Intergenic
1044937457 8:97306884-97306906 TAGCTGCCTTTGTAGTTTAAAGG - Intergenic
1045300486 8:100906634-100906656 TATGTGACTTTGAAATTGAAAGG + Intergenic
1045627045 8:104065673-104065695 TAGGAGGATTTGAAGTTATAAGG + Intronic
1046333644 8:112754811-112754833 TATGAGACTTTGAAGTCAAAAGG - Intronic
1048239418 8:132726414-132726436 TACATAACATTGAAGTTAAATGG - Intronic
1051766616 9:20531437-20531459 TAGGTGAATATAAAGTTGAAAGG - Intronic
1057455752 9:95208405-95208427 TGGGTGACTTTTCTGTTAAAAGG - Intronic
1058020638 9:100083520-100083542 TAGGTGACTGAGAACTGAAAGGG + Intronic
1058129501 9:101233917-101233939 TAGCTGACTTTGGAATTACATGG - Intronic
1059943221 9:119378398-119378420 TAGATGCCTTTAAAGTAAAAGGG + Intergenic
1061728372 9:132594143-132594165 TATTTGCCTTTGAAGTCAAAAGG - Exonic
1186686384 X:11929240-11929262 TAGTTAACTTTTAAGTTCAAGGG - Intergenic
1188286586 X:28333579-28333601 CAGGTTTCTTTGCAGTTAAAAGG + Intergenic
1193420228 X:81274089-81274111 AAAATGACTTTGGAGTTAAAAGG - Intronic
1193535684 X:82712590-82712612 TATTTCACTCTGAAGTTAAAGGG + Intergenic
1194001640 X:88436972-88436994 TGGGTAACTTGGAAGTGAAAGGG + Intergenic
1195039272 X:100999449-100999471 AATGTGATTTTGAAGATAAAGGG + Intergenic
1195464294 X:105163027-105163049 TAGCTGATCTAGAAGTTAAAGGG - Intronic
1196191730 X:112801817-112801839 TAAGTGACCTTGTAGTTAGAAGG + Intronic
1196283723 X:113855128-113855150 TAGGTGACTATGTAGTTTAAAGG + Intergenic
1196394619 X:115245870-115245892 TAGGTTGATTTGAAGTTTAATGG - Intergenic
1197601480 X:128536364-128536386 TAAGGGAAATTGAAGTTAAATGG - Intergenic
1198000779 X:132433546-132433568 TAGGTGAAGTAGAAGTCAAATGG - Intronic
1198227974 X:134663978-134664000 CAAGAGACTTTGAAGTTATATGG + Intronic
1198649865 X:138850657-138850679 AAAGTGACTTTGAAATAAAAAGG + Intronic
1199045524 X:143166610-143166632 TTGATGACTTTGAGGTCAAATGG + Intergenic
1199161981 X:144623731-144623753 CAGGTGACTTTGACGTTGATGGG - Intergenic