ID: 1072601413

View in Genome Browser
Species Human (GRCh38)
Location 10:96934415-96934437
Sequence GCTTATGACTCTATAGCTCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 164
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 150}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1072601413_1072601415 -7 Left 1072601413 10:96934415-96934437 CCTAGAGCTATAGAGTCATAAGC 0: 1
1: 0
2: 0
3: 13
4: 150
Right 1072601415 10:96934431-96934453 CATAAGCTCTGTGGACTTCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1072601413 Original CRISPR GCTTATGACTCTATAGCTCT AGG (reversed) Intronic
900334476 1:2154907-2154929 GCTTATCACTCGGTAGCGCTGGG + Intronic
903449721 1:23444696-23444718 CCTTCTGACTCTAAAGTTCTGGG + Intronic
904436869 1:30504749-30504771 GCTGGTGGCTCTACAGCTCTGGG - Intergenic
907170846 1:52462899-52462921 GCAAATGACTTTATAACTCTTGG - Intronic
908313362 1:62907947-62907969 GCTTATGACTCTAAATCCCAAGG - Intergenic
909521825 1:76577352-76577374 GATTAAGAGGCTATAGCTCTTGG - Intronic
909695757 1:78466094-78466116 GCTTAGGAGTCTAAAGCCCTTGG + Intronic
914776583 1:150741255-150741277 GCTTATAACTCTAGAGCTTTGGG - Intronic
916803315 1:168234457-168234479 CCATTTGACTCTATAGCTATTGG - Intronic
917740662 1:177959109-177959131 GGTAATGAGTCTATAGCTATAGG + Intronic
918446680 1:184623826-184623848 GCTTATGAGTGAATACCTCTGGG + Exonic
921974025 1:221181840-221181862 GTTTTTGACTCCATAGGTCTTGG - Intergenic
923405474 1:233655004-233655026 GTCTATGACTCTACAGGTCTGGG - Intronic
1064148935 10:12847369-12847391 GATTATGACTCAACAGATCTGGG + Intergenic
1069285870 10:66714693-66714715 GCTTCTGACTCAGTAGTTCTGGG - Intronic
1070445272 10:76493327-76493349 GCTTAAGACTCAAGGGCTCTTGG + Intronic
1071369794 10:84939676-84939698 GCTTCTGATTCAATAGGTCTTGG - Intergenic
1071978055 10:90975294-90975316 GCTTATGCTTCTATAACTCATGG + Intergenic
1072601413 10:96934415-96934437 GCTTATGACTCTATAGCTCTAGG - Intronic
1072807797 10:98435616-98435638 CCTGGTGAGTCTATAGCTCTGGG - Exonic
1074599557 10:114899984-114900006 TCTTATGACTTTCTAGTTCTTGG - Intergenic
1078704976 11:13734742-13734764 GTTTCTGACTCAATAGATCTGGG - Intergenic
1078742551 11:14080685-14080707 GCTCTTGACTCTATAGGTCAAGG + Intronic
1079353189 11:19710549-19710571 GCTTTTGATTCAATAGGTCTGGG + Intronic
1080920455 11:36703746-36703768 GTTTCTGATTCTATAGGTCTAGG + Intergenic
1081981876 11:47271896-47271918 GCTCATGACTCTATTGCAGTTGG + Intronic
1086204517 11:84241871-84241893 GATTCTGATTCTATAGCTTTGGG + Intronic
1087462505 11:98462982-98463004 GCTGGTGGCTCTATAGGTCTGGG - Intergenic
1088078483 11:105880454-105880476 GCTTTTCACTCTATAGTTCTAGG + Intronic
1088252718 11:107875108-107875130 GCTTCTGATTCAATAGGTCTAGG - Intronic
1089861075 11:121590492-121590514 GATTCTGACTCTGTAGGTCTGGG - Intronic
1091092654 11:132787037-132787059 GATTCTGAATCTATAGGTCTAGG + Intronic
1091791449 12:3274362-3274384 CCTTAAGATTCTTTAGCTCTCGG - Intronic
1095374628 12:41511962-41511984 CCTTATAACCCTATAGCTCTAGG + Intronic
1098060293 12:66554347-66554369 GCTTCTGACTTAAGAGCTCTTGG + Intronic
1100729170 12:97444995-97445017 ACTTAGGACCCTATAGCTTTGGG + Intergenic
1101812142 12:108116546-108116568 GATTCTGGCTCTATAGGTCTGGG + Intergenic
1107276105 13:38681087-38681109 GCTTCTGTCTCTGTTGCTCTTGG - Intergenic
1107297612 13:38928238-38928260 GCATATGATTTTATTGCTCTTGG - Intergenic
1107938139 13:45362145-45362167 GTATATGACTCTAGAGCACTTGG - Intergenic
1108880305 13:55105387-55105409 TCTTATGACTATATATCACTTGG + Intergenic
1114539885 14:23447049-23447071 GCTAATGTCTCAATAGATCTAGG - Intergenic
1114866404 14:26599090-26599112 GCTTATGATTATACAGATCTTGG + Intergenic
1115459721 14:33646883-33646905 GCTGATTACTCTATACCTCTGGG - Intronic
1117809275 14:59529511-59529533 GCCTATGACTTTACAGCTTTGGG + Intronic
1118419180 14:65581160-65581182 GTTTATGACTCAGTAGGTCTGGG - Intronic
1119954558 14:78782692-78782714 GCTCATGACTCATTAGCTTTTGG - Intronic
1125110497 15:36026473-36026495 TCTTCTGACACTATGGCTCTGGG - Intergenic
1133434942 16:5771062-5771084 GTTTATGACTCAGTAGATCTGGG - Intergenic
1134024801 16:10945456-10945478 GGGAATGACTCTACAGCTCTGGG + Intronic
1135701582 16:24637455-24637477 GACTATGACTCCATAGTTCTAGG + Intergenic
1137700065 16:50491110-50491132 TCATATGCCTCTATACCTCTTGG - Intergenic
1137833914 16:51572186-51572208 GCTAAAGACCCTAGAGCTCTAGG + Intergenic
1140408664 16:74727729-74727751 GATTCTGTCTCTCTAGCTCTTGG - Intronic
1143074171 17:4326080-4326102 TCTTTTGTCTCTATTGCTCTTGG - Intronic
1146512039 17:33458249-33458271 TCTCTTGACTCTAAAGCTCTTGG - Intronic
1149086975 17:52729754-52729776 GATTATGATTCAGTAGCTCTTGG - Intergenic
1149277500 17:55059703-55059725 GATTCTGATTCTATAGATCTGGG - Intronic
1149560148 17:57602865-57602887 GATTCTGACTCTGTAGGTCTAGG - Intronic
1149794655 17:59508117-59508139 GTTTATGACCTTATAGCTCCAGG - Intergenic
1150622471 17:66818504-66818526 GCCAATGGCTCTATAGTTCTGGG - Intergenic
1157774093 18:50377452-50377474 GCTTATTACTCTATATCACTGGG + Intronic
1158036230 18:53034183-53034205 GTATATGACTCTAAAGCTCGGGG - Intronic
1162051512 19:8036718-8036740 GCTTATGATACTTTAGATCTAGG + Intronic
1167860876 19:52282825-52282847 GCTTTTGATTCTATAGTTCTTGG + Intronic
1167875188 19:52406313-52406335 GCTTTTGATTCTATAGTTCTTGG + Intronic
925519317 2:4723968-4723990 GCTTTTGACTTTGTAGCTATAGG - Intergenic
926301984 2:11611229-11611251 CCTTATGACTTTAGACCTCTGGG + Intronic
928372880 2:30753879-30753901 GATGCAGACTCTATAGCTCTGGG - Intronic
931664491 2:64600444-64600466 GCTTCTGACTTTGTAGCTCTGGG + Intergenic
932590592 2:73064355-73064377 GATTCTGATTCTATTGCTCTGGG + Intronic
934152222 2:89157947-89157969 TCTTCTGTCACTATAGCTCTAGG + Intergenic
934215029 2:90023958-90023980 TCTTCTGTCACTATAGCTCTAGG - Intergenic
935758450 2:106296667-106296689 GTTTCTGACTCTATAGGTCTGGG + Intergenic
944379559 2:199092340-199092362 GTTTATGGCTCTGTAGTTCTGGG + Intergenic
945272032 2:207950505-207950527 GATTTTGACTCTGTAGATCTTGG + Intronic
946169526 2:217886415-217886437 CCTTATGACTCTGCAGCTCTCGG + Intronic
947737352 2:232463213-232463235 GCTGATGACTTAATAGCTCCAGG + Intergenic
1172024719 20:31940466-31940488 GATTGTGACTCCATAGGTCTAGG + Intronic
1173595739 20:44257641-44257663 GCCTGTGACTCTAGAGCTCGGGG - Intronic
1174053264 20:47781867-47781889 GCTGATGTCTCTCCAGCTCTGGG - Intronic
1174536215 20:51253575-51253597 GCTTTTGACTCTGTGGCTCTGGG + Intergenic
1174683145 20:52427550-52427572 GTTTATGACTCAGTAGGTCTGGG - Intergenic
1175271573 20:57737674-57737696 GCCTATGACTCTGCAGTTCTTGG - Intergenic
1177887041 21:26759868-26759890 GTTAATGATTCTAAAGCTCTGGG - Intergenic
1178712255 21:34928263-34928285 ACTTAAGAGTCTAGAGCTCTAGG + Intronic
1183268165 22:36843665-36843687 GCTTATGACTCTAAAGTGCCTGG - Intergenic
951590084 3:24255107-24255129 GCTTATGCCTCCTTTGCTCTTGG + Intronic
951619222 3:24582785-24582807 GATTCTGACTCAATAGGTCTGGG + Intergenic
952187344 3:30984319-30984341 GCTTCTGATTCAATAGCTCTGGG + Intergenic
952505875 3:34006393-34006415 GCTGGTGCCTCTATAGCTTTTGG + Intergenic
953645195 3:44747141-44747163 GCCTGTGATTCTGTAGCTCTTGG + Intronic
954081487 3:48214655-48214677 GTTTCTGACTCAATAGGTCTAGG + Intergenic
955397177 3:58565823-58565845 GCTTCTAACTCAATAGATCTGGG - Exonic
955454180 3:59101644-59101666 GCTTGTGACACCATAGCCCTGGG - Intergenic
955737569 3:62056038-62056060 ACATATGACTCTATAGCCCAAGG + Intronic
957391762 3:79582903-79582925 GTTTATTACACTATAGCTTTAGG - Intronic
963096115 3:141542763-141542785 GGTTATGACTATAAAGCTATGGG - Intronic
963734407 3:149003656-149003678 GCTTCTGATTCTGTAGGTCTGGG + Intronic
965132628 3:164721358-164721380 ACTTATGACTATATATTTCTAGG - Intergenic
966573937 3:181478086-181478108 GATTATGATTCTGTAGGTCTGGG + Intergenic
967260909 3:187641048-187641070 ACTTATGACTCTGTGACTCTGGG - Intergenic
972036785 4:34533289-34533311 GCTTAAGATTTTATAGCTTTAGG - Intergenic
975670296 4:76773530-76773552 GCTGCTGATGCTATAGCTCTGGG - Intronic
976215545 4:82712206-82712228 GATTCTGACTCAATAGGTCTGGG + Intronic
977122699 4:93123551-93123573 CCTTATGAGTCTATATCCCTTGG - Intronic
978653885 4:111043262-111043284 GCTTATCCCTCTAAAGATCTGGG - Intergenic
980877551 4:138677093-138677115 CCTTGAGACTCTATATCTCTGGG + Intergenic
982693765 4:158576480-158576502 GCTTTTGATTCAATAGGTCTGGG - Intronic
983454439 4:167945185-167945207 TCTTCTGCCTCTATAACTCTAGG - Intergenic
985814915 5:2119924-2119946 GCTTAAAAATCTATATCTCTAGG - Intergenic
986677380 5:10198063-10198085 GCTAATAAATTTATAGCTCTAGG - Intergenic
988116176 5:26894190-26894212 GCTTATGTCTGAATAGATCTTGG + Intronic
989811277 5:45679099-45679121 GCATATGACTGAATACCTCTGGG + Intronic
992322372 5:75626307-75626329 GCTCATTACTGTATAGCTTTGGG - Intronic
995589211 5:113681389-113681411 GCACATGACTATATAGCTCTAGG - Intergenic
996020134 5:118581709-118581731 TCTTATGACTATATTGCTCAAGG + Intergenic
999038218 5:148377388-148377410 CCTGATGACTCTGTAGCCCTAGG - Intergenic
999190743 5:149745399-149745421 GATTCTCACTCTATAGGTCTGGG - Intronic
999201404 5:149819081-149819103 GCTTCTGATTCAGTAGCTCTGGG + Intronic
1000710491 5:164569404-164569426 GTATATGAATCTAAAGCTCTAGG + Intergenic
1003287960 6:4751328-4751350 GATTTTGACTCCATAGGTCTGGG - Intronic
1003862557 6:10335792-10335814 GCTGATGATTCTGTAACTCTTGG - Intergenic
1014155418 6:118103734-118103756 GATTATGACCCAATAGATCTGGG + Intronic
1014316596 6:119873747-119873769 GGTTATGACACTATTGCACTTGG - Intergenic
1014321328 6:119931922-119931944 GCATATGACTGTATAGGTCATGG + Intergenic
1015912317 6:138181342-138181364 GTTGATGACTTTATAACTCTGGG + Intronic
1017582718 6:155884037-155884059 GATTATGACTCAGTAGGTCTGGG + Intergenic
1020353459 7:7250921-7250943 GCCTTTGAATTTATAGCTCTTGG + Intergenic
1023685430 7:42729552-42729574 GCTAATGATTCAGTAGCTCTTGG - Intergenic
1025222478 7:57126383-57126405 GCTTATGTATCTTTTGCTCTAGG - Intronic
1025266457 7:57462775-57462797 GCTTATGTATCTTTTGCTCTTGG + Intronic
1025633266 7:63298057-63298079 GCTTATGTATCTTTTGCTCTAGG - Intergenic
1025649430 7:63450132-63450154 GCTTATGTATCTTTTGCTCTAGG + Intergenic
1025720395 7:64005927-64005949 GCTTATGTATCTTTTGCTCTAGG + Intergenic
1025742815 7:64213407-64213429 GCTTATGTATCTTTTGCTCTAGG + Intronic
1030275308 7:107714522-107714544 GTTTATGACTCTATGGATATAGG + Intronic
1035762561 8:2080314-2080336 GCTTTTGAGTCTGCAGCTCTAGG - Intronic
1038199794 8:25401330-25401352 GTTTATGATTCCATAGATCTGGG + Intronic
1038869499 8:31479090-31479112 GATTATGAATCAATAGGTCTGGG - Intergenic
1040844483 8:51822686-51822708 GATTATGACTCTGGAGCTCAGGG + Intronic
1043496372 8:80805254-80805276 GCTTGTGATGCTGTAGCTCTGGG + Intronic
1046837505 8:118819307-118819329 GGCTATGACCCTATAGCTGTGGG - Intergenic
1048519249 8:135138579-135138601 GCTGATGGCTCTACAGTTCTGGG + Intergenic
1050802860 9:9637678-9637700 GCTGGTGGCTCTATAGTTCTGGG + Intronic
1051776679 9:20641745-20641767 TCTGATGACTGTATACCTCTGGG - Intergenic
1053581417 9:39408700-39408722 GTTAATGACTCTATTGCTCAGGG + Intergenic
1053845896 9:42236733-42236755 GTTAATGACTCTATTGCTCAGGG + Intergenic
1054102998 9:60967452-60967474 GTTAATGACTCTATTGCTCAGGG + Intergenic
1054583357 9:66939361-66939383 GTTAATGACTCTATTGCTCAGGG - Intergenic
1055791940 9:79931764-79931786 GATTTTGACTCTGTAGGTCTGGG + Intergenic
1057492200 9:95529125-95529147 GATTCTGACTCAATAGATCTTGG - Intergenic
1059156265 9:111991238-111991260 GCTTCTAACTTTATAGCTGTAGG + Intergenic
1060654966 9:125365165-125365187 GCTCATGACTCCATAGCTGGCGG + Intronic
1185872309 X:3674253-3674275 GGTTCTGCATCTATAGCTCTCGG - Intronic
1186196500 X:7114609-7114631 GCTTCTGATTCTGTAGATCTGGG - Intronic
1189102971 X:38210182-38210204 GCTTGTGATTCAGTAGCTCTGGG + Intronic
1189440691 X:41032905-41032927 GCTTCTGATTCAGTAGCTCTGGG + Intergenic
1189910766 X:45808714-45808736 GCTCATGACTCCTTAGCTTTTGG + Intergenic
1196557414 X:117105325-117105347 GTTTCTGATTCTATAGGTCTTGG + Intergenic
1199091454 X:143697746-143697768 TCTTATCACTGTATAGCTTTGGG + Intergenic
1199496383 X:148457217-148457239 GCTTCTGATTCTTTAGGTCTGGG + Intergenic
1199845244 X:151688158-151688180 GCTTCTGACTAAATAGCCCTTGG + Intergenic
1200791597 Y:7304428-7304450 GGTTCTGCATCTATAGCTCTCGG + Intergenic