ID: 1072603908

View in Genome Browser
Species Human (GRCh38)
Location 10:96961238-96961260
Sequence GCTAATTCTGCAACCGTTTG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 63
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 58}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1072603908 Original CRISPR GCTAATTCTGCAACCGTTTG GGG Intronic
904471235 1:30737693-30737715 GGTAATTCTGCAACAGATTTGGG + Exonic
910728498 1:90363769-90363791 GCTCCTTCTGCAACCCTCTGTGG - Intergenic
912673373 1:111652383-111652405 GCTAATTATGAAACAGTTAGAGG + Intronic
921812228 1:219528174-219528196 GCTGATTCTGCAACTGAGTGTGG - Intergenic
924667521 1:246088736-246088758 GCTAATTTTTCAAACTTTTGGGG - Intronic
1063594669 10:7423404-7423426 TCTAATTCTGCAAACATTCGTGG - Intergenic
1067494642 10:46750860-46750882 GCTTGTTCTGCGACTGTTTGGGG - Intergenic
1068257587 10:54533401-54533423 GATAATTCTGCAAGAATTTGAGG + Intronic
1072603908 10:96961238-96961260 GCTAATTCTGCAACCGTTTGGGG + Intronic
1078777577 11:14407886-14407908 GCTATTTCTGAAACTGTTTCAGG - Intergenic
1083666066 11:64275417-64275439 GCCCATTCTCCAACCCTTTGGGG + Intronic
1097864118 12:64544631-64544653 GCTATTTTTTCAACGGTTTGGGG + Intergenic
1099702132 12:86098581-86098603 GCTATTTCTGCTACAGTTTTAGG + Intronic
1100196564 12:92253019-92253041 GCTAGTTCTACAACTGATTGGGG - Intergenic
1100846638 12:98665620-98665642 GCTTATTCTGAAGCTGTTTGAGG - Exonic
1101664359 12:106797108-106797130 GGTAATTATTCAACCTTTTGAGG - Intronic
1102802531 12:115749088-115749110 GCTCATTCAGCAATTGTTTGTGG - Intergenic
1118485228 14:66208271-66208293 GCTAAATCTGCAAGTGTTTCTGG - Intergenic
1128301216 15:66567486-66567508 GCTATTACTGGAACCGTTAGAGG + Intergenic
1130914584 15:88294901-88294923 CTTAATTCTTCAACCCTTTGAGG - Intergenic
1140034385 16:71361319-71361341 CCTAATTCTGGATCCTTTTGTGG - Intronic
1143260118 17:5592420-5592442 GCTAAATTTGCAACTGTCTGGGG + Intronic
1155062504 18:22241366-22241388 GCTAGTTCTGCAACTGTGAGTGG + Intergenic
1157755267 18:50211925-50211947 GTTACTTCTGCAACCACTTGCGG - Intergenic
1162260584 19:9530595-9530617 GCTAATTCTTCAAAATTTTGTGG - Intronic
928940495 2:36722317-36722339 GCTAATGCTGCAGTCGTTTGGGG - Intronic
938409462 2:131051955-131051977 GATGATTCTTCAACCTTTTGGGG - Exonic
943308218 2:186293859-186293881 GCTAATTCTACAGCCTTCTGAGG + Intergenic
1169601943 20:7271345-7271367 GCCAATTCTTTAACCATTTGAGG + Intergenic
1178302314 21:31463371-31463393 GCAGATTCTGGAACCCTTTGAGG - Intronic
1179408817 21:41146508-41146530 GCTCATCCAGCAACCTTTTGAGG - Intergenic
1184788844 22:46686705-46686727 ACTTATTCTGTAACGGTTTGTGG - Exonic
950793871 3:15494850-15494872 ATTAATTCAGCAAACGTTTGTGG - Intronic
956571655 3:70703436-70703458 GCTAATTCTCCAACCTTCTAAGG + Intergenic
960236587 3:115289981-115290003 GCTAATTATGCATCAGTGTGAGG - Intergenic
965074871 3:163963566-163963588 GCTAATTCTTGAACACTTTGGGG - Intergenic
974322707 4:60371706-60371728 GATAAATCTGCAATCGTTTCAGG - Intergenic
976582244 4:86750796-86750818 ACCAACTCTGCAACGGTTTGTGG - Exonic
978804616 4:112787287-112787309 GGTAATTTTGAAACAGTTTGAGG - Intergenic
987329798 5:16846589-16846611 GCTAATTATGGACCTGTTTGTGG - Intronic
995453056 5:112323762-112323784 GGTTATTCTGCAACCTTTTTGGG + Intronic
998928180 5:147150895-147150917 GCTAATACTTCAGCAGTTTGTGG + Intergenic
1008513732 6:52300252-52300274 GCAAATTCTGCAGCAGTTGGGGG + Intergenic
1011832853 6:91394102-91394124 GCTAACTCTGCATTTGTTTGTGG + Intergenic
1018700859 6:166424887-166424909 GCTGACTCTGCTACCCTTTGAGG - Intronic
1026618566 7:71929780-71929802 GGTAATTGTTCAGCCGTTTGAGG + Intronic
1030088848 7:105839934-105839956 GCTAATTCTGCATGGGTCTGAGG + Intronic
1034549154 7:151809292-151809314 GCTGATTCTGCACCCGTCTCGGG - Intronic
1039356508 8:36823086-36823108 GCTAATTCAGCAATTGTTAGGGG + Intronic
1040297094 8:46157905-46157927 GCTAATTTTGAAACTGTTTTGGG - Intergenic
1041837445 8:62232481-62232503 GCTAATCCTGCACCTGTTGGAGG - Intergenic
1044146697 8:88724944-88724966 CCTAATTCTGCAACCATTCTGGG - Intergenic
1046207748 8:111024128-111024150 GTTAATTTTGCAACACTTTGAGG - Intergenic
1052390575 9:27874220-27874242 GATAATTCTGCAAGAATTTGTGG + Intergenic
1055638919 9:78304268-78304290 GCTAATCCTGCAACCAATGGTGG - Intronic
1058626603 9:106939852-106939874 GCTGATTCTGCAATCATTTGAGG - Intronic
1059903722 9:118958131-118958153 GCTAACACTCCAACCGTTAGTGG + Intergenic
1185948644 X:4405594-4405616 GATAATTATGCAGCTGTTTGGGG + Intergenic
1190635535 X:52429738-52429760 GTTAATTCTGCAAACATTTGTGG - Intergenic
1192484098 X:71510251-71510273 GCCACTTCTGCAATGGTTTGAGG - Intronic
1193102665 X:77633371-77633393 GCTAATTCAGAAACCTTTTGTGG + Exonic
1197571617 X:128156924-128156946 GCTAGTTCTGCACCTGTCTGAGG + Intergenic
1201905570 Y:19082954-19082976 GCTGATTCTGCATCCCATTGAGG - Intergenic