ID: 1072606452

View in Genome Browser
Species Human (GRCh38)
Location 10:96987503-96987525
Sequence ACAGCCTAGAATGGGAAAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1072606452_1072606455 -10 Left 1072606452 10:96987503-96987525 CCTTCTTTCCCATTCTAGGCTGT No data
Right 1072606455 10:96987516-96987538 TCTAGGCTGTGTGTGAGAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1072606452 Original CRISPR ACAGCCTAGAATGGGAAAGA AGG (reversed) Intergenic
No off target data available for this crispr