ID: 1072608157

View in Genome Browser
Species Human (GRCh38)
Location 10:97000603-97000625
Sequence CTGTAGCAGCAGAATGAACC AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 291
Summary {0: 1, 1: 0, 2: 3, 3: 27, 4: 260}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1072608152_1072608157 5 Left 1072608152 10:97000575-97000597 CCAGAGCCTGGCCTACCACCAGC 0: 1
1: 0
2: 2
3: 29
4: 280
Right 1072608157 10:97000603-97000625 CTGTAGCAGCAGAATGAACCAGG 0: 1
1: 0
2: 3
3: 27
4: 260
1072608149_1072608157 12 Left 1072608149 10:97000568-97000590 CCCCGCTCCAGAGCCTGGCCTAC 0: 1
1: 0
2: 2
3: 20
4: 205
Right 1072608157 10:97000603-97000625 CTGTAGCAGCAGAATGAACCAGG 0: 1
1: 0
2: 3
3: 27
4: 260
1072608151_1072608157 10 Left 1072608151 10:97000570-97000592 CCGCTCCAGAGCCTGGCCTACCA 0: 1
1: 0
2: 2
3: 23
4: 262
Right 1072608157 10:97000603-97000625 CTGTAGCAGCAGAATGAACCAGG 0: 1
1: 0
2: 3
3: 27
4: 260
1072608153_1072608157 -1 Left 1072608153 10:97000581-97000603 CCTGGCCTACCACCAGCAGATTC 0: 1
1: 0
2: 3
3: 38
4: 259
Right 1072608157 10:97000603-97000625 CTGTAGCAGCAGAATGAACCAGG 0: 1
1: 0
2: 3
3: 27
4: 260
1072608146_1072608157 29 Left 1072608146 10:97000551-97000573 CCAGCAGGAGGCGGCACCCCCGC 0: 1
1: 0
2: 1
3: 28
4: 193
Right 1072608157 10:97000603-97000625 CTGTAGCAGCAGAATGAACCAGG 0: 1
1: 0
2: 3
3: 27
4: 260
1072608150_1072608157 11 Left 1072608150 10:97000569-97000591 CCCGCTCCAGAGCCTGGCCTACC 0: 1
1: 0
2: 1
3: 36
4: 325
Right 1072608157 10:97000603-97000625 CTGTAGCAGCAGAATGAACCAGG 0: 1
1: 0
2: 3
3: 27
4: 260
1072608155_1072608157 -10 Left 1072608155 10:97000590-97000612 CCACCAGCAGATTCTGTAGCAGC 0: 1
1: 0
2: 0
3: 21
4: 337
Right 1072608157 10:97000603-97000625 CTGTAGCAGCAGAATGAACCAGG 0: 1
1: 0
2: 3
3: 27
4: 260
1072608148_1072608157 13 Left 1072608148 10:97000567-97000589 CCCCCGCTCCAGAGCCTGGCCTA 0: 1
1: 1
2: 0
3: 13
4: 228
Right 1072608157 10:97000603-97000625 CTGTAGCAGCAGAATGAACCAGG 0: 1
1: 0
2: 3
3: 27
4: 260
1072608154_1072608157 -6 Left 1072608154 10:97000586-97000608 CCTACCACCAGCAGATTCTGTAG 0: 1
1: 0
2: 1
3: 20
4: 170
Right 1072608157 10:97000603-97000625 CTGTAGCAGCAGAATGAACCAGG 0: 1
1: 0
2: 3
3: 27
4: 260

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1072608157 Original CRISPR CTGTAGCAGCAGAATGAACC AGG Exonic
900196188 1:1376794-1376816 CTTGAGGAGCAGGATGAACCAGG + Intergenic
900676538 1:3890690-3890712 GTGCAGAAGCAGAATGAGCCAGG - Exonic
900874365 1:5331081-5331103 CTGTCACAGCAGAATGTTCCAGG + Intergenic
901837989 1:11936457-11936479 CTGTATCACCAGAAGGATCCCGG + Intronic
902575996 1:17377995-17378017 CAGAAGCAGCAGGATGACCCAGG - Intronic
903426307 1:23256909-23256931 CTGAGGCAGGAGAATCAACCAGG - Intergenic
904259274 1:29279176-29279198 CTGTAGCAGCAGAGAGAAAGAGG - Intronic
904946783 1:34205200-34205222 CAGAAGCAGCAGAAGGACCCTGG + Intronic
905011412 1:34749448-34749470 CTGTCGCAGCAGCATGAAACAGG + Intronic
907466438 1:54640882-54640904 CTGAAGCAGCAGAAGGAGACTGG + Intergenic
907508711 1:54942486-54942508 CTTTATCAGCAGCATGAAACTGG + Intergenic
909095989 1:71290051-71290073 CTTTATCAGCAGAATGAAAGTGG + Intergenic
910654697 1:89608038-89608060 CTGATGCAGCTGAATGAACACGG + Intergenic
911512419 1:98824075-98824097 CTGGGGCAGGAGAATGAACCTGG - Intergenic
911695600 1:100887795-100887817 CTGAGGCAGGAGAATGACCCGGG - Intronic
912392106 1:109310531-109310553 CTGAAGCAGGAAAATGAACATGG - Exonic
912665529 1:111576198-111576220 CAGTAGCATCAGAATCAACTGGG - Intronic
912695581 1:111839497-111839519 CTGAAGCAGGAAAATGAACAAGG - Intronic
913388694 1:118286963-118286985 CTGAGGCAGGAGAATGAGCCCGG + Intergenic
915262093 1:154684289-154684311 CTGAGGCAGGAGCATGAACCCGG + Intergenic
917892265 1:179451880-179451902 CTTTATCAGCAGAATGAAAATGG + Intronic
918429552 1:184444571-184444593 CTTTATCAGCAGAATGAAAATGG + Intronic
920337455 1:205254716-205254738 CTGCACCACCAGAATGAACTGGG - Intronic
922530342 1:226340451-226340473 CTTTATCAGCAGCATGAACATGG + Intergenic
922983365 1:229847578-229847600 CAGGAGCAGCAGAATGACCAAGG + Intergenic
923142299 1:231170926-231170948 CTGCAGCATCAGCATCAACCTGG + Intronic
924637857 1:245805898-245805920 CTGAAGCAGTAGAAGGAACTTGG - Intronic
1063132507 10:3190328-3190350 CTGTATCAGCAGATGGAACGTGG + Intergenic
1063191178 10:3696355-3696377 CAGTAGCAACACAATGAACCCGG + Intergenic
1064968742 10:21041321-21041343 CTGTAGCTCTAGAATGAAGCTGG - Intronic
1065426316 10:25608006-25608028 CTGTAGAAGCAGAATGCAAGGGG - Intergenic
1065795269 10:29301354-29301376 CTTTATCAGCAGAATGAAAATGG + Intronic
1065921425 10:30396649-30396671 CATTAGCAGCAGAATAAAACTGG - Intergenic
1066754110 10:38692426-38692448 CTTTATCAGCAGAATGAAAACGG + Intergenic
1069055475 10:63840078-63840100 CTTTACCAGCAGCATGAAACTGG + Intergenic
1069127989 10:64661865-64661887 CTTTAGCAGCAGCATGAAAATGG - Intergenic
1069725422 10:70574481-70574503 GTGCAGAGGCAGAATGAACCTGG + Intergenic
1072608157 10:97000603-97000625 CTGTAGCAGCAGAATGAACCAGG + Exonic
1073726419 10:106236590-106236612 CTTTATCAGCAGCATGAACATGG - Intergenic
1075234558 10:120714998-120715020 CTGTCACAGCACAGTGAACCAGG - Intergenic
1076016771 10:127034140-127034162 CTTTATCAGCAGCATGAACAGGG - Intronic
1076200332 10:128552702-128552724 CTTTATCAGCAGCATGAACACGG + Intergenic
1076765970 10:132633287-132633309 GTGAAGCTGCAGAATGTACCGGG - Intronic
1077508029 11:2941126-2941148 CTGCTCCAGCAGAAGGAACCTGG + Intergenic
1078851138 11:15165017-15165039 CTGTATCAGCAGCATGAAAATGG + Intronic
1079531753 11:21462669-21462691 CTGGAGCTGCAGGATGAACAAGG - Intronic
1083024546 11:59539250-59539272 CTGCAACAGCAGAATGAAATTGG + Intergenic
1085740565 11:79074898-79074920 CTGTAGCAACAGCAAGAAACTGG - Intronic
1086750613 11:90489405-90489427 CTTTAGCAGCAGCATGAAAATGG + Intergenic
1086850192 11:91799430-91799452 CTTTATCAGCAGAATGAAAATGG - Intergenic
1087091173 11:94274624-94274646 CTCCAGCAGCAGAAGGAAACAGG - Intergenic
1087647927 11:100829401-100829423 CTGTGATAGCAGAATTAACCTGG - Intronic
1088559055 11:111094100-111094122 CTGTTGCAGGAGAATGACCCTGG - Intergenic
1091040803 11:132279347-132279369 CTCTAGCAGCAGAATGGAGGAGG - Intronic
1091353535 11:134916246-134916268 ATGTACCAGCAGAAGAAACCAGG - Intergenic
1093170851 12:15858792-15858814 CTGTAGCAGCAGCAGAATCCAGG + Intronic
1097041926 12:56161007-56161029 CTATAGCAGCAGAATGGGGCAGG - Intronic
1097899073 12:64856037-64856059 CTGTATAAGCAGCATGACCCTGG + Intronic
1103112111 12:118289692-118289714 ATTTAGAAACAGAATGAACCTGG + Intronic
1103333292 12:120169953-120169975 CTGGAGCAACAGAATGAAGGAGG + Intronic
1105854239 13:24360997-24361019 CTGAGGCTGCTGAATGAACCGGG - Intergenic
1107216808 13:37931187-37931209 CTGTATCAGCAAAATGAAAAAGG - Intergenic
1108152078 13:47546571-47546593 CTGTAGGAGAAAAATGACCCTGG + Intergenic
1111001917 13:82195765-82195787 CAGTAGCAGCAGCAAGAACAGGG - Intergenic
1111067174 13:83108223-83108245 CTTTATCAGCAGCATGAAACTGG + Intergenic
1113984934 13:114306497-114306519 CTGAGGCAGGAGAATGAACCTGG + Intergenic
1114467219 14:22931539-22931561 CTGAGGCAGGAGAATGACCCAGG + Intergenic
1116068881 14:40017795-40017817 CTTTACCAGCAGCATGAAACTGG - Intergenic
1116181079 14:41536648-41536670 ATGAAGCAGAAGAATGAAACTGG - Intergenic
1117213473 14:53526087-53526109 CTGCAGAACCAGCATGAACCAGG + Intergenic
1117788831 14:59316974-59316996 CTGTAGCACACAAATGAACCAGG - Intronic
1118546550 14:66895884-66895906 TTACAGCAGCAGAATGGACCAGG - Intronic
1118668575 14:68098418-68098440 CTTTATCAGCAGAGTGAAACTGG - Intronic
1118732183 14:68676268-68676290 ATGTACCAGCTGAATGACCCAGG - Intronic
1120008864 14:79390422-79390444 CTGTAGCAGCAGAAAGAGGTAGG - Intronic
1120014215 14:79451730-79451752 CTGGAGCAGCAGAATGCAAAGGG - Intronic
1120104777 14:80481133-80481155 CTTTAGCAGCAGCATGAAAATGG - Intronic
1120321837 14:82972664-82972686 CTGTGGCAACATGATGAACCTGG + Intergenic
1122498454 14:102176825-102176847 CTGAGGCAGGAGAATGAACCCGG - Intronic
1122852831 14:104546189-104546211 CTGAAGCAGCGGAATCACCCTGG + Intronic
1125795793 15:42403095-42403117 CAGGAGCAGCAGAAGGACCCTGG - Intronic
1126422359 15:48488016-48488038 CTGGGGCAGCAGGAAGAACCTGG + Intronic
1127262590 15:57337113-57337135 CTGGAGGAGCAGCATGAACATGG + Intergenic
1128373915 15:67062168-67062190 CTGTGGCACCAGAATGACCTGGG - Intergenic
1128418634 15:67470274-67470296 CTGAGGCAGGAGTATGAACCTGG - Intronic
1128767561 15:70260489-70260511 CTGCAGCAGCAGAATGAGTGTGG - Intergenic
1129477937 15:75799175-75799197 CTTTAGCAGCAGGATAAAACTGG + Intergenic
1129735897 15:77962953-77962975 CTTTAGCAGCAGAATACAACTGG - Intergenic
1129836021 15:78706482-78706504 CTTTAGCAGCAGAATAAAACTGG + Intronic
1130511323 15:84592157-84592179 CTTTAGCAGCAGAATAAAACTGG - Intergenic
1131618818 15:94045371-94045393 CTGTAGCAGGAGATGGAACATGG - Intergenic
1133621492 16:7530923-7530945 CAGCAGCAGCAGAATGTACCTGG + Intronic
1133772118 16:8872925-8872947 CTGAGGCAGGAGAATCAACCGGG + Intergenic
1135074941 16:19384979-19385001 CAGGAGCAGAAGAATGAACCAGG + Intergenic
1135985059 16:27178020-27178042 CCGAGGCAGGAGAATGAACCCGG + Intergenic
1140449290 16:75057482-75057504 CTGTAAGACCAGAATGAATCTGG - Intronic
1140485525 16:75290213-75290235 CTGTGGCTGCAGAATGGAGCAGG - Intergenic
1141138228 16:81480575-81480597 CTGGAGCAGCAGAATGGGTCAGG - Intronic
1141777521 16:86134258-86134280 CTGTATCAGCAGGATGTGCCTGG - Intergenic
1142187130 16:88699863-88699885 TTTTAGCAGCAGAAGGGACCGGG - Intronic
1143455782 17:7066792-7066814 CTGAAGCAGGAGAAAGAAACTGG + Intergenic
1144612539 17:16735496-16735518 TTTTGGCAGCAGAATGAAACTGG - Intronic
1144645859 17:16972922-16972944 CTGTGGCAGGAGAATGAACCTGG + Intergenic
1144900189 17:18579782-18579804 TTTTGGCAGCAGAATGAAACTGG + Intergenic
1145132257 17:20365883-20365905 TTTTGGCAGCAGAATGAAACTGG - Intergenic
1149746628 17:59105668-59105690 CTGTAGGGCCAGAAAGAACCTGG + Intronic
1149796946 17:59529574-59529596 CTGTGGCACAAGAATCAACCTGG - Intergenic
1150971365 17:70031940-70031962 CTGTATCAGCAGCATGAAAACGG - Intergenic
1151195071 17:72425509-72425531 CTGTATCAGCAGCATGAAAATGG + Intergenic
1151329305 17:73397497-73397519 CTGTGACAGCAGAGTGATCCTGG - Intronic
1153740082 18:8115689-8115711 CTGTAGCAGAAGATTTAATCAGG + Intronic
1154312984 18:13281881-13281903 CTTTATCAGCAGCATGAATCCGG - Intronic
1155660846 18:28246605-28246627 CTGGAGCAACAGCATGAACAGGG + Intergenic
1155675808 18:28426843-28426865 CTTTATCAGCAGCATGAACATGG + Intergenic
1155713169 18:28907402-28907424 CTGAGGCAACAGAATGAACCTGG + Intergenic
1156265736 18:35487311-35487333 CTGTATCAGCAGCATGAAAATGG - Intronic
1156563702 18:38159367-38159389 CTGTGGCAGCAGAATCATCAGGG - Intergenic
1159227997 18:65565367-65565389 CATTAGCAGCAGATAGAACCAGG - Intergenic
1159617380 18:70597499-70597521 CTTTATCAGCAGCATGAACACGG + Intergenic
1160801946 19:974342-974364 CCGTAGCAGCACAATCACCCCGG + Exonic
1161948793 19:7455656-7455678 CTTTATCAGCAGCATGAACACGG - Intronic
1162738730 19:12761624-12761646 CTGAGGCAGGAGAATGAACCCGG - Intergenic
1163836878 19:19580372-19580394 CGGTAGCAGCAGCAAGACCCTGG - Intronic
1166410208 19:42551638-42551660 CTTTAGCAGCAGCATGAAAATGG + Intronic
1166557936 19:43713816-43713838 CTGCTGCAGCAGAATGAATGAGG + Intergenic
926225013 2:10961249-10961271 CTGGAGGAGCAGAACGAGCCCGG - Intergenic
927257913 2:21056424-21056446 CAGCAGCAGCAGAATAACCCAGG + Intergenic
927997055 2:27494118-27494140 CTGCAGCGGCAGAATGGCCCCGG - Exonic
928582663 2:32724819-32724841 CTGTATCAGCAGCATGAAAATGG - Intronic
928786216 2:34888920-34888942 GTGTAGATGCAGATTGAACCTGG + Intergenic
929882168 2:45846627-45846649 CTGTGGCTGCAGAAAGAAACAGG - Intronic
931932146 2:67150543-67150565 CTGAGGCAGGAGAATGAACCTGG + Intergenic
934317410 2:91936763-91936785 CTTTATCAGCAGAATGAAAACGG + Intergenic
934873000 2:97885288-97885310 CTGAGGCAGGAGAATGGACCGGG - Intronic
936294089 2:111252090-111252112 CTGGAGAAGCAGAATCAACTGGG - Intergenic
936370763 2:111899870-111899892 CTGTTCAAGCAGAATGAAACCGG - Intronic
937008057 2:118536024-118536046 CTCTAGAAGCAGAATGGATCAGG - Intergenic
937176119 2:119937128-119937150 CTGTAGCATGAGAATCAGCCAGG + Intronic
937571311 2:123365691-123365713 CAGTAGCAGCAGAAAGCAGCAGG + Intergenic
938084947 2:128393426-128393448 CTTTAGCAGCAGCATGAAAATGG + Intergenic
940039567 2:149346353-149346375 CTGCAGCAGCTCAATGAACTTGG + Intronic
940299927 2:152166078-152166100 CTGTAGTCCCAGATTGAACCTGG + Intronic
945086502 2:206137373-206137395 CTAAGGCAGGAGAATGAACCCGG + Intronic
945989648 2:216384463-216384485 CTGAGGCAGGAGAATCAACCTGG + Intergenic
947038415 2:225886590-225886612 ATGTAACAGCAGAATGATGCAGG + Intergenic
947248723 2:228078156-228078178 CTGTATCAGCAGCATGAAAATGG + Intronic
1169034478 20:2438375-2438397 CTGTATCAGCAGAAATCACCTGG - Intergenic
1169494814 20:6104939-6104961 CTGAAGCAGCGGATTGAATCGGG + Intronic
1170781326 20:19428148-19428170 CAGTAGCAGCAGCATGAGCCCGG + Intronic
1171178855 20:23076744-23076766 CAGATGCAGCAGAATGAATCGGG + Intergenic
1177075813 21:16571829-16571851 CTGTAGTTGCACAATGAACATGG + Intergenic
1177598575 21:23280631-23280653 CTGGAGGAGAAGAATGACCCAGG - Intergenic
1177730540 21:25023193-25023215 CTTTACCTGCAGAATGACCCTGG + Intergenic
1179310342 21:40189871-40189893 CTGTATCAGCAGCATGAAAACGG + Intronic
1180004400 21:45013391-45013413 CTGTAGCAGCAGGCTGCCCCTGG - Intergenic
1180305585 22:11120555-11120577 CTTTAACAGCAGAATGAAAACGG + Intergenic
1180544104 22:16482734-16482756 CTTTAACAGCAGAATGAAAACGG + Intergenic
1182148058 22:28009547-28009569 CAGAAGCAGGAGAATGATCCAGG + Intronic
1182263055 22:29089741-29089763 CTGGAGCAGGAGAATGAGCAGGG - Intronic
1183850676 22:40584635-40584657 CCGTAGCAGGAGAATCACCCAGG + Intronic
1184639950 22:45865408-45865430 CTGTGGAAGCAGCATGGACCCGG + Intergenic
1184764023 22:46562201-46562223 CTGTGGCTGCTGAATGACCCAGG - Intergenic
1185182941 22:49373437-49373459 CTGTGGCAGCAGCATGAGGCTGG - Intergenic
949426194 3:3918729-3918751 CTGTAAGAGCAGAGTGAAGCAGG + Intronic
949819728 3:8103235-8103257 CTGTAGCAGAAAGATGAACAAGG - Intergenic
949959415 3:9299809-9299831 CTGAGGCAGGAGATTGAACCTGG + Intronic
951025905 3:17829735-17829757 CTGAGCCAGGAGAATGAACCTGG - Intronic
951044520 3:18023142-18023164 CTGCAGCAACAGTATCAACCTGG + Intronic
951505128 3:23436312-23436334 ATGGAACAGCAGAATGAACCTGG - Intronic
952782674 3:37118294-37118316 CTGATGCAGCAGAATCACCCAGG - Intronic
954567453 3:51610503-51610525 CTGAGGCAGGAGAATAAACCTGG + Intronic
958954952 3:100457284-100457306 CTCTGGCATCAGAATGAACTGGG - Intergenic
959269419 3:104187815-104187837 CATTTGCAGAAGAATGAACCTGG - Intergenic
959985391 3:112565677-112565699 CTGAAGCAGGAGAATGAACCCGG + Intronic
961022953 3:123524823-123524845 CTGATGCAGCAGAAAGACCCTGG + Intronic
961145548 3:124590042-124590064 ATGTCTCAGCAGAATCAACCAGG + Intronic
963345633 3:144093653-144093675 CTTTATCAGCAGCATGAAACTGG + Intergenic
963553386 3:146754111-146754133 CTTTATCAGCAGCATGAACACGG - Intergenic
963774972 3:149429428-149429450 CTAAAGCAGCAGCATTAACCTGG + Intergenic
963860981 3:150310104-150310126 CTGAAGCATGAGAATGAACCTGG - Intergenic
964532523 3:157683795-157683817 CTGGAGCAGCAGATTAAATCAGG - Intergenic
966690961 3:182740942-182740964 CTGTAACAGTAGAATGAGCAAGG - Intergenic
967668702 3:192206088-192206110 CTTTAGCAGCAGACAGAACCAGG + Intronic
970422156 4:15915409-15915431 ATCTAGTAGCAGAATGATCCAGG - Intergenic
971134674 4:23855253-23855275 CTTTAGCAGCAGAGTGAGACTGG + Intronic
972128816 4:35803088-35803110 CTTTATCAGCAGCATGAACACGG - Intergenic
972688140 4:41370643-41370665 CTCTAACAGCATAATGAATCAGG - Intronic
973694256 4:53474621-53474643 CTGTAGTAACAGAATAAACATGG - Intronic
976462471 4:85328311-85328333 CAGTAGCAGCAGAATGGACTGGG - Intergenic
977285303 4:95098649-95098671 AAGCAGCAGCAGAATGAACCTGG - Intronic
977512195 4:97974809-97974831 CTTTATCAGCAGCATGAACATGG + Intronic
977949650 4:102955383-102955405 CTTTATCAGCAGAATGAAAACGG + Intronic
979406023 4:120311314-120311336 CTTTATCAGCAGAATGAAAACGG - Intergenic
979471170 4:121098715-121098737 CTGTAGAAGTAGAATGAGCCTGG - Intergenic
979501046 4:121440075-121440097 CAGTGGCAGCAGAAAGAAACGGG + Intergenic
979922842 4:126523691-126523713 CTTTATCAGCAGCATGAACATGG - Intergenic
979923942 4:126536330-126536352 CTGAGGCAGAAGAATGAACCCGG - Intergenic
979943118 4:126788129-126788151 CTGTAACAGCACAATCATCCAGG - Intergenic
980509991 4:133772663-133772685 CTTTAGCAGCAGCATGAAAATGG - Intergenic
982497980 4:156115484-156115506 CTATAGCAGCACCATGAAACAGG + Intergenic
983478418 4:168243187-168243209 CTTTATCAGCAGCATGAACATGG + Intronic
987225252 5:15833146-15833168 CTTTATCAGCAGAATGAAAGCGG + Intronic
987992594 5:25233982-25234004 CTGTAAAAGTAGAATTAACCAGG + Intergenic
988204234 5:28114348-28114370 CTTTATCAGCAGCATGAACATGG - Intergenic
989034746 5:37158880-37158902 CTGAGGCAGGAGAATGAACCCGG - Intronic
989731545 5:44655473-44655495 CTCTATCAGCAGCATGAAACTGG + Intergenic
989952888 5:50321653-50321675 CTGCATCACCAGAATGAATCGGG + Intergenic
991143355 5:63273079-63273101 CTTTATCAGCAGCATGAACATGG - Intergenic
992122692 5:73610928-73610950 CTGTATCAGCAGCATGAAAACGG - Intergenic
992411041 5:76505372-76505394 TGGTAGCAGCAGAAAGAGCCTGG - Intronic
994764829 5:103902902-103902924 CTTTAGCAGCAGCATGAAAATGG - Intergenic
996307192 5:122060796-122060818 CTGCAGGAGCAGATGGAACCAGG - Intronic
1000801767 5:165736860-165736882 CTGTAGCAGCAGCAGGCTCCAGG + Intergenic
1001844961 5:174914131-174914153 CTTTAGCAGCAGAATAAAACTGG - Intergenic
1008603221 6:53116074-53116096 CTGTAGTAGCAGAAGGCGCCAGG - Intergenic
1010474374 6:76267935-76267957 CTGTATCAGCAGCATGAAAATGG + Intergenic
1011140546 6:84150875-84150897 CTGTAGGAGGAGAATGAGCATGG - Intronic
1011885685 6:92092045-92092067 CTGAGGCAGGAGAATGAAGCCGG + Intergenic
1012194277 6:96319102-96319124 CTTTATCAGCAGAATGAAAATGG - Intergenic
1012657197 6:101839023-101839045 CTGGTGCAGGAGCATGAACCTGG - Intronic
1014268517 6:119310466-119310488 CTGGCCCAGCTGAATGAACCAGG + Intronic
1014509461 6:122303056-122303078 CTGTTGCAGTGGAATGAAGCTGG - Intergenic
1014552617 6:122806660-122806682 CTGGAGAAGAAGAATGAACATGG - Intronic
1014624823 6:123712618-123712640 TTGTATCATCAGAATAAACCAGG + Intergenic
1014715645 6:124861863-124861885 CTGTATCAGCAGCATGAAAATGG - Intergenic
1016074949 6:139784937-139784959 CTGTTGCAGAAGATTGAAACTGG - Intergenic
1016936137 6:149450722-149450744 CTGTACCAGGAGGATGAGCCTGG + Exonic
1017315907 6:153031110-153031132 CTGGAGCAGGAGAATAAAACAGG + Intronic
1018129845 6:160718468-160718490 CCATAGCAGCAGAATGAGACCGG - Intronic
1018147167 6:160902270-160902292 CTTTAGCATCAGAATGATGCTGG + Intergenic
1018485936 6:164241220-164241242 CTTTATCAGCAGAATGAAAGTGG - Intergenic
1022137296 7:27460788-27460810 CCTTAGCAGAAGAATGAATCAGG - Intergenic
1022846171 7:34212233-34212255 CTGTAGCCACAGAATGAGGCAGG - Intergenic
1023437995 7:40158106-40158128 CTGAGGCAGGAGATTGAACCCGG + Intronic
1024560199 7:50638048-50638070 CATAAGCAGAAGAATGAACCTGG + Intronic
1024594178 7:50918212-50918234 CTGTAGCAGCAGAAGCTAACTGG + Intergenic
1024823897 7:53366552-53366574 CTTGAGCAGTAGATTGAACCTGG - Intergenic
1025717110 7:63969656-63969678 CTGTGGCAGGAGCTTGAACCTGG - Intergenic
1026288061 7:68981074-68981096 CTTTGGAAGCTGAATGAACCAGG + Intergenic
1026584786 7:71647431-71647453 CTGTAGGAGCAGGAGGAACTGGG - Intronic
1028544166 7:91979166-91979188 CTGTATCAGCAGCATGAAAATGG - Intronic
1029000657 7:97151311-97151333 CTGTAGCTGCAGAAAGAAATAGG + Intronic
1029292154 7:99510330-99510352 CTGACGCAGGAGAATCAACCCGG - Intronic
1029547322 7:101217230-101217252 CGGCAGCAGCAGCAGGAACCGGG + Exonic
1031278700 7:119766892-119766914 CTGTAGCAGTAAAATAAAACAGG - Intergenic
1031719740 7:125158289-125158311 CTTTAACAGTAAAATGAACCAGG + Intergenic
1031939490 7:127772801-127772823 CCTTGGTAGCAGAATGAACCAGG + Intronic
1034592409 7:152152828-152152850 CAGTAGCCACAGAATCAACCCGG - Exonic
1037878517 8:22561312-22561334 CTGCAGGAGCAGAAGGGACCAGG - Intronic
1039772419 8:40700790-40700812 CTGTAGAAGAAGAATGTACAAGG - Intronic
1040478511 8:47802574-47802596 CTGAGGCAGGAGAATGAACCTGG - Intronic
1041263050 8:56038281-56038303 CTGTAGCAACAAAATCAATCTGG - Intergenic
1041840831 8:62268785-62268807 TTGTAGCAGTAGAGAGAACCTGG - Intronic
1045356808 8:101396653-101396675 CTGTAACAGCAGAAAGGACAGGG + Intergenic
1046020720 8:108661564-108661586 ATGGAGCAGCAGCTTGAACCAGG + Intronic
1046877035 8:119266584-119266606 GTGTAGGAGCAGAATGAAGGAGG + Intergenic
1047621686 8:126613942-126613964 CTTTATCAGCAGAATGAAAATGG + Intergenic
1048810945 8:138285479-138285501 CTGTCGCTACAGAAGGAACCTGG - Intronic
1049117633 8:140703167-140703189 CTAAGGCAGGAGAATGAACCCGG + Intronic
1050661842 9:7891469-7891491 CTTTATCAGCAGAATGAAAATGG - Intergenic
1051126317 9:13809759-13809781 CTGTGGCTGCAGAAAGACCCAGG - Intergenic
1053593242 9:39534095-39534117 CCGTAGCAGCACAATCACCCCGG - Intergenic
1053850976 9:42288803-42288825 CCGTAGCAGCACAATCACCCCGG - Intergenic
1054573064 9:66831182-66831204 CCGTAGCAGCACAATCACCCCGG + Intergenic
1054871434 9:70050344-70050366 TTGAAGGGGCAGAATGAACCAGG - Intronic
1055370300 9:75591283-75591305 CAGTAGCAGCAGAACCAACTGGG - Intergenic
1055661404 9:78507402-78507424 CTCTAGCAGGAGAATGAAAAAGG + Intergenic
1056505374 9:87253361-87253383 CTTTATCAGCAGCATGAACACGG - Intergenic
1058241287 9:102564442-102564464 TTGTAGTAGCAGAAAGACCCTGG + Intergenic
1060179406 9:121522670-121522692 CTTTAGCAGCAGCATGAAAATGG + Intergenic
1061871935 9:133525548-133525570 CTGAAGCAGCAGCATCCACCAGG - Intronic
1062324204 9:136004598-136004620 CTGTAACAGCAGAATCAGGCCGG + Intergenic
1186495091 X:10006749-10006771 CTGAAGCAGCAGCAGGAGCCTGG + Intergenic
1187132597 X:16517212-16517234 CAGTCGCAGCAGAAAGAAACAGG + Intergenic
1187528962 X:20079477-20079499 CTGTAGCTGTAGAAAGAACCAGG - Intronic
1188342171 X:29017303-29017325 CTGTAGAATAAGAATGAACGTGG + Intronic
1189554366 X:42126788-42126810 CTGTAGCATCAGAAGGATTCTGG + Intergenic
1190491490 X:50987235-50987257 CTTTATCAGCAGAGTGACCCTGG - Intergenic
1191596017 X:62944932-62944954 CTTTAGCAGCAGCATGAAAGTGG - Intergenic
1191690554 X:63933920-63933942 CTGTAGGAGCAGCAAGATCCAGG - Intergenic
1192305228 X:69952225-69952247 CTTTATCAGCAGAATGAAAATGG - Intronic
1193502824 X:82301010-82301032 CTTTAGTATCAGAATGAAGCTGG - Intergenic
1193788070 X:85784543-85784565 CTGAAGCAGGAGCGTGAACCCGG + Intergenic
1193813579 X:86080926-86080948 CTTTATCAGCAGCATGAAACTGG - Intergenic
1194715260 X:97280377-97280399 CTGAGGCAGAAGAACGAACCCGG + Intronic
1195574717 X:106437030-106437052 TTGTAGCAGCAGAAAGAACCGGG - Intergenic
1197067090 X:122246281-122246303 AACTAGCAGCAGAATGAATCAGG + Intergenic
1197379584 X:125722746-125722768 CTTTATCAGCAGCATGAAACCGG + Intergenic
1200274533 X:154719114-154719136 GTCTAGCAGAAGAATGAACCAGG + Intronic
1201261335 Y:12161691-12161713 CTTTAGCAGCAGAATGAAAACGG - Intergenic
1201416303 Y:13752029-13752051 CCGCAGCACCAGAAAGAACCCGG - Intergenic