ID: 1072610869

View in Genome Browser
Species Human (GRCh38)
Location 10:97017083-97017105
Sequence CCTTACAGAATGCGGGCTGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1072610869_1072610877 -8 Left 1072610869 10:97017083-97017105 CCCGCAGCCCGCATTCTGTAAGG No data
Right 1072610877 10:97017098-97017120 CTGTAAGGCAGTGAGGTGAGGGG No data
1072610869_1072610884 23 Left 1072610869 10:97017083-97017105 CCCGCAGCCCGCATTCTGTAAGG No data
Right 1072610884 10:97017129-97017151 ATCTCCCCATCTCAGGGTGAAGG No data
1072610869_1072610876 -9 Left 1072610869 10:97017083-97017105 CCCGCAGCCCGCATTCTGTAAGG No data
Right 1072610876 10:97017097-97017119 TCTGTAAGGCAGTGAGGTGAGGG No data
1072610869_1072610878 -7 Left 1072610869 10:97017083-97017105 CCCGCAGCCCGCATTCTGTAAGG No data
Right 1072610878 10:97017099-97017121 TGTAAGGCAGTGAGGTGAGGGGG No data
1072610869_1072610879 16 Left 1072610869 10:97017083-97017105 CCCGCAGCCCGCATTCTGTAAGG No data
Right 1072610879 10:97017122-97017144 CTGCCCCATCTCCCCATCTCAGG No data
1072610869_1072610886 25 Left 1072610869 10:97017083-97017105 CCCGCAGCCCGCATTCTGTAAGG No data
Right 1072610886 10:97017131-97017153 CTCCCCATCTCAGGGTGAAGGGG No data
1072610869_1072610875 -10 Left 1072610869 10:97017083-97017105 CCCGCAGCCCGCATTCTGTAAGG No data
Right 1072610875 10:97017096-97017118 TTCTGTAAGGCAGTGAGGTGAGG No data
1072610869_1072610887 26 Left 1072610869 10:97017083-97017105 CCCGCAGCCCGCATTCTGTAAGG No data
Right 1072610887 10:97017132-97017154 TCCCCATCTCAGGGTGAAGGGGG No data
1072610869_1072610880 17 Left 1072610869 10:97017083-97017105 CCCGCAGCCCGCATTCTGTAAGG No data
Right 1072610880 10:97017123-97017145 TGCCCCATCTCCCCATCTCAGGG No data
1072610869_1072610885 24 Left 1072610869 10:97017083-97017105 CCCGCAGCCCGCATTCTGTAAGG No data
Right 1072610885 10:97017130-97017152 TCTCCCCATCTCAGGGTGAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1072610869 Original CRISPR CCTTACAGAATGCGGGCTGC GGG (reversed) Intronic