ID: 1072611100

View in Genome Browser
Species Human (GRCh38)
Location 10:97018247-97018269
Sequence CTGCTCCTGCCAGGTGCCAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 271
Summary {0: 1, 1: 0, 2: 0, 3: 28, 4: 242}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1072611100_1072611107 -1 Left 1072611100 10:97018247-97018269 CCCATGGCACCTGGCAGGAGCAG 0: 1
1: 0
2: 0
3: 28
4: 242
Right 1072611107 10:97018269-97018291 GGAAGAAGGCCTGGAGCAGGAGG No data
1072611100_1072611105 -10 Left 1072611100 10:97018247-97018269 CCCATGGCACCTGGCAGGAGCAG 0: 1
1: 0
2: 0
3: 28
4: 242
Right 1072611105 10:97018260-97018282 GCAGGAGCAGGAAGAAGGCCTGG No data
1072611100_1072611106 -4 Left 1072611100 10:97018247-97018269 CCCATGGCACCTGGCAGGAGCAG 0: 1
1: 0
2: 0
3: 28
4: 242
Right 1072611106 10:97018266-97018288 GCAGGAAGAAGGCCTGGAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1072611100 Original CRISPR CTGCTCCTGCCAGGTGCCAT GGG (reversed) Intronic
900363152 1:2299618-2299640 CTTCTCCTGCCAGATCCCACAGG - Intronic
900512086 1:3065554-3065576 CTGACCCTGCCAGTTGGCATGGG + Intergenic
900642169 1:3692915-3692937 CTGCTGCTGCCCGGTGCCCTGGG + Intronic
900852438 1:5154552-5154574 CTCCTCCTGCCATGTGAAATAGG + Intergenic
900940012 1:5792632-5792654 CTGCACCTGCAAGGTGCTACAGG + Intergenic
901831506 1:11895090-11895112 CTGCCCCTGCCAGGTTCCTGGGG - Intergenic
901838784 1:11940732-11940754 CTGGTCCAGCCAGCTGCCTTGGG - Intronic
902176218 1:14652905-14652927 CTCCACCTGCCAGATGCCAGTGG - Intronic
902447036 1:16474137-16474159 CGGCTCCTCCCAGGAGCCATAGG - Intergenic
902478159 1:16698853-16698875 CAGTTCCTGCCAGGGGCCCTGGG - Intergenic
902559490 1:17268028-17268050 CTGTTCCTGCCTTGGGCCATGGG + Intronic
903069426 1:20719460-20719482 CTGCTTCTGCAATGTGCCACAGG - Intergenic
903225979 1:21894459-21894481 TGGCTCCTGCCAGCTGCCCTTGG - Intronic
904677656 1:32208181-32208203 CTGCTCCTGCCCCTGGCCATTGG + Exonic
905425210 1:37878290-37878312 GTGCTCCTGCCTGGTGTGATCGG - Exonic
906662872 1:47594836-47594858 CGGCTCCTGCCAGCTGCCCTCGG - Intergenic
908527633 1:65002897-65002919 CTGCTCCTTCCAGGTCCCGGCGG + Intergenic
908992116 1:70103753-70103775 CTGCTTCTGTCAAGTCCCATAGG - Intronic
909527595 1:76644204-76644226 CTGCTTCTGCCTTCTGCCATGGG - Intergenic
910235730 1:85034332-85034354 CTGATCCTGGCAGGTTCCCTTGG + Intronic
910293481 1:85621178-85621200 CTGCTTCTGCCAGGTACCCTGGG - Intergenic
911683861 1:100750255-100750277 TTCCTCCTCCCGGGTGCCATGGG - Intergenic
915125781 1:153663083-153663105 CTGTTCCTGCCAGGTTCAGTGGG - Exonic
915544264 1:156587039-156587061 CAGCTCCTGCCAGCAGCCACAGG + Intergenic
915837565 1:159189765-159189787 CTGCTCCTGCCAGTAGCCTGGGG - Exonic
918140410 1:181714926-181714948 CTTCTCTTGCCAGTGGCCATGGG - Intronic
918188443 1:182148381-182148403 CTCCTCTTGCCTGGGGCCATTGG - Intergenic
919009730 1:191944856-191944878 TTGCTCCTGCCAGGTGACAATGG - Intergenic
919921710 1:202169991-202170013 GTGCTGCTGCCAGGCCCCATCGG + Intergenic
922593963 1:226799362-226799384 CTCCTCCTGCCAGCTCCCACAGG - Intergenic
923015016 1:230120082-230120104 ATGCTCCGGCCAGGTGCCGAGGG - Intronic
1064367341 10:14719742-14719764 CTCCTCCTGCCAGGTGGCCTTGG + Intronic
1066297134 10:34064690-34064712 CTGATCCTGCCATGTCCTATTGG - Intergenic
1067458872 10:46442834-46442856 GTGCTGCTTCCAGTTGCCATGGG + Intergenic
1067628322 10:47941801-47941823 GTGCTGCTTCCAGTTGCCATGGG - Intergenic
1067704863 10:48599090-48599112 CTGCACATGCTAGGTGCAATAGG + Intronic
1067795717 10:49320285-49320307 CTCCTCCTGCCTTGTGACATGGG - Intronic
1067802042 10:49365869-49365891 CTGCTGCCACCAAGTGCCATCGG + Exonic
1072611100 10:97018247-97018269 CTGCTCCTGCCAGGTGCCATGGG - Intronic
1074125830 10:110528186-110528208 CTGCTCCTGCCATTTGCTCTGGG + Intergenic
1074698719 10:116074568-116074590 CTGCTCCTCCAAGATGCCAGTGG + Intronic
1074851728 10:117444562-117444584 CTGCCTCTGCCAGGGTCCATAGG - Intergenic
1074974002 10:118565925-118565947 GGGCTTCTGCCAGGTCCCATTGG - Intergenic
1076290292 10:129340605-129340627 CTGCTCCTCCCAGTTCCCTTTGG + Intergenic
1076845829 10:133069159-133069181 CAGCTCCTGCCAGCTGCTGTGGG + Intergenic
1077263418 11:1635816-1635838 CTGCTGCTGTGGGGTGCCATAGG - Intergenic
1078016730 11:7621273-7621295 CAGCTTCAGCCAGGTGCTATGGG - Intronic
1079008184 11:16807400-16807422 ATGCTCCTCCCATGGGCCATGGG + Intronic
1079762313 11:24344432-24344454 CTGCTCCTGCCCAGTGCAAAAGG + Intergenic
1083063870 11:59903071-59903093 CTTCTCCTGGAAGGTTCCATAGG - Intergenic
1083113448 11:60435156-60435178 TTGCTTCTGCCAGGTACCAGGGG - Intronic
1083272442 11:61579269-61579291 ATACTCCTGCCACGGGCCATGGG + Intronic
1083310014 11:61779246-61779268 GCGCTCCTGCCATGGGCCATGGG - Exonic
1083337056 11:61928720-61928742 CTGCTTCTGCCTGGAGCCAGGGG - Intergenic
1083602200 11:63955688-63955710 CTGCTCCAGCCTGTTGCCACAGG - Exonic
1083912295 11:65717245-65717267 GTGCTCCTGCCTGGAGCCATGGG + Intronic
1084178715 11:67436295-67436317 CTGGCCCTGCCAGGGGCCTTGGG - Exonic
1084296580 11:68216207-68216229 CTCCTCCTGCCAGCTGGCAGGGG + Intergenic
1085303391 11:75471742-75471764 GTGGTCATGCCAGGTGCCCTTGG + Intronic
1085418688 11:76337228-76337250 CTGCCCCTCTCAGGGGCCATAGG + Intergenic
1087545163 11:99575764-99575786 CTCCTCCTGTCTGGTGGCATTGG - Intronic
1089291793 11:117441737-117441759 CTGGTCGTGCCAGGTGCCAAGGG + Intronic
1090480196 11:127061213-127061235 CTGCTCTTACCAGGGGCCACTGG + Intergenic
1090487463 11:127126904-127126926 CTGCTCAAGCCAGAGGCCATGGG - Intergenic
1095260962 12:40099011-40099033 ATGCTCCTGCCACGTGGCCTTGG + Intronic
1096639698 12:52984295-52984317 CTGCCCCTAGCAGGTTCCATGGG - Intergenic
1097011466 12:55956210-55956232 CCTCTCCTGCCAGGTTCCCTGGG - Exonic
1097617495 12:61900560-61900582 CTTCTCCTTCCTGCTGCCATTGG - Intronic
1098056452 12:66511197-66511219 CTTCTCCTGTCTGCTGCCATGGG + Intronic
1101186098 12:102281269-102281291 CTGATCCTTCCAGGTTCCACAGG - Intergenic
1102867414 12:116385046-116385068 CTGCACCTACCAGCTGCCAATGG - Intergenic
1103844757 12:123893591-123893613 CTGCCCCTTCTAGGTGCCAGTGG + Intronic
1103897043 12:124279761-124279783 CAGCTCCCCGCAGGTGCCATGGG - Intronic
1103994401 12:124819788-124819810 CTGCTCCTTCCGGGGGACATGGG - Intronic
1104488865 12:129176814-129176836 CTGTCCCTGGCATGTGCCATGGG + Intronic
1104927073 12:132319363-132319385 CTGCTCCTGCCTGTGGACATCGG + Intronic
1105419572 13:20240313-20240335 CTGCTCCTTCCAGGGGCCGATGG + Intergenic
1105423066 13:20270297-20270319 CTGCTTCTGCCAGCTGCTCTCGG + Intergenic
1106114078 13:26801949-26801971 CTGCTCCTGCTTGGAGCCAGGGG - Intergenic
1106495014 13:30268172-30268194 TTGCTTCAGCCAGGTGCCTTAGG - Intronic
1107671998 13:42755613-42755635 CTGCTCTTGTCAGAGGCCATTGG + Intergenic
1113057669 13:106287296-106287318 CTGCCCCTGCCATGTTCCAGTGG + Intergenic
1114930965 14:27466618-27466640 CTGGACCTCCCAGGTGTCATGGG - Intergenic
1116709951 14:48355469-48355491 TTGCTGCTTCCAGGTGTCATGGG + Intergenic
1117602800 14:57391466-57391488 CTCCTCCTGCTCGGTGCCCTCGG - Exonic
1118760979 14:68880001-68880023 CTGCTCCTGGCTGATGCCCTTGG + Exonic
1119561413 14:75592845-75592867 TTTCTCCTGCCAGATGCCCTAGG + Intronic
1123921601 15:25073906-25073928 CTGCACCTTCCTGGTGTCATTGG + Intergenic
1123922290 15:25078849-25078871 CTGCACTTCCCAGGTGGCATGGG + Intergenic
1124634721 15:31357700-31357722 CTGCACCTGCCAGGAACCAGAGG - Intronic
1125574297 15:40744863-40744885 CTGCCCCTACAAGGTGACATGGG - Intronic
1126564995 15:50085558-50085580 CTTCTAGTGCCAGGTGCCGTAGG - Intronic
1126778807 15:52120744-52120766 CAGCTCCTGCCAGGTGCTGAAGG - Exonic
1128097569 15:64969617-64969639 CTACTCCAGCCAGGTGCCCATGG + Intronic
1128385632 15:67146422-67146444 CTGCTCTGGCCACGTGCCCTGGG - Intronic
1130321337 15:82844964-82844986 GGGCTCCTGCCAGGTGCCCTGGG + Intronic
1130544361 15:84843662-84843684 TTGCTTCTGCCAGGTGCCTGAGG - Intronic
1132668196 16:1091324-1091346 CTGCTCCTGCCCGGGCCCAGTGG + Intronic
1132669833 16:1098046-1098068 CGGCTGCTGCCGGGTGCCCTGGG + Intergenic
1132699944 16:1218059-1218081 CTGGGGCTGCCAGGTGCCAGAGG - Intronic
1132825056 16:1900539-1900561 CTGCTGCTGCCATGTCCCTTCGG - Intergenic
1133786683 16:8979247-8979269 TTGCTTCTGCCAGGTGCCTTGGG + Intergenic
1135966253 16:27037533-27037555 CTCCTCCTGCCAGATGTCACAGG - Intergenic
1139294052 16:65884618-65884640 CTGGTCCTGCAGGGTGCCCTGGG + Intergenic
1140144063 16:72288207-72288229 TTGCTCCTGCCAAATGCCACAGG - Intergenic
1142263447 16:89053035-89053057 CTTCCCCTGCCAGGTCCCCTGGG + Intergenic
1142815521 17:2422019-2422041 CCGCGCCCGGCAGGTGCCATTGG - Intronic
1143506813 17:7370803-7370825 TTGCTTCTGCCAGATGCCAGAGG - Intergenic
1146054947 17:29576335-29576357 GTGCTCCCGCCTGGCGCCATGGG + Exonic
1147311333 17:39597542-39597564 CAGCTCGTGCCAGGAGCGATTGG + Intergenic
1147909529 17:43847247-43847269 CTGCTGCTCCCAGGTGAGATGGG + Exonic
1148577472 17:48722149-48722171 GTGCTCCCGCCAGGTGGTATCGG + Intronic
1148875287 17:50683597-50683619 CCCCTCCTGCCAGGCGCCCTGGG + Exonic
1150069657 17:62140093-62140115 CTGCTCCTCCCAGGGGCTCTCGG + Intergenic
1150784588 17:68152262-68152284 CTGCTCCTCCCATCTCCCATGGG - Intergenic
1155021334 18:21899879-21899901 CTTCTCATGCCAGATGCCATAGG + Intergenic
1155160771 18:23193532-23193554 CAGCTCCTGCCATGGGACATGGG - Intronic
1156611014 18:38723877-38723899 CTGCTCCTACCAGGTGGAAATGG + Intergenic
1157293286 18:46425022-46425044 CTGCCCCTCCCTGGTGCCTTTGG + Intronic
1160728527 19:629792-629814 CTGCTCCTCCCAGGGGCTCTCGG + Exonic
1161504399 19:4636181-4636203 CTGCCCCGGCCCAGTGCCATGGG - Intergenic
1161862611 19:6809511-6809533 CTGCTCCAGCCAGGTGGAAGTGG - Intronic
1162126166 19:8500456-8500478 CTTCTCCCTCCAGCTGCCATGGG - Intronic
1163019398 19:14474456-14474478 CTGCCCATGGCAGTTGCCATGGG + Intronic
1163395632 19:17059089-17059111 CTCCACCTGCCAGGTGCCAGGGG - Intronic
1163411928 19:17160319-17160341 CAGCCCCTGCCTGGTGCCTTTGG - Intronic
1163639940 19:18456492-18456514 CTGCTCCTCCCTGGTGCCAAGGG - Intronic
1164853519 19:31503304-31503326 CTGCACCTGCCAGGTGAGACAGG + Intergenic
1164940989 19:32252194-32252216 CCTCTCCTGCCACGTGACATTGG + Intergenic
1165361704 19:35341004-35341026 TGGCTCCTCCCAGGCGCCATGGG - Exonic
1165830230 19:38727042-38727064 CTGCTCCTGGCTGATGCCCTTGG - Exonic
1165894546 19:39133735-39133757 CTGCTCCTGCCACCTGTCCTGGG + Intronic
1166558840 19:43718882-43718904 CGGCTCCTGGCAGGTCCCAGAGG - Exonic
1166960355 19:46493156-46493178 CTGCGCCTGGCAGGTGCTGTAGG - Exonic
1167317146 19:48771090-48771112 CTGCTGGTGCCAGCTGCCAAGGG - Intergenic
1167807728 19:51800150-51800172 CGGCTCTTGCAAGGTGCCCTGGG - Intronic
1202712180 1_KI270714v1_random:24681-24703 CAGTTCCTGCCAGGGGCCCTGGG - Intergenic
925578146 2:5381595-5381617 CTGCTGCTGCCATGTGAGATGGG + Intergenic
925580067 2:5401377-5401399 CTGCTCCTGCCAGGAACCAGTGG + Intergenic
927728401 2:25447301-25447323 CTGCTTCTACCAGGTGCCTTGGG + Intronic
928484687 2:31718121-31718143 CTTATCCTGTAAGGTGCCATGGG - Intergenic
929876404 2:45800453-45800475 TGGCACCTGCCAGGTGCCACAGG - Intronic
930014745 2:46962627-46962649 CTGCTCCTGCCATGGCTCATTGG + Intronic
931903406 2:66816999-66817021 CTGCTCCTGGGAGGTGCAAAAGG - Intergenic
933780299 2:85796359-85796381 CTGCTCCTTCCAGGCCCCCTTGG + Intergenic
934165988 2:89294629-89294651 CAGCTCCTCCCAGGTGCCCCAGG + Intergenic
934201289 2:89887827-89887849 CAGCTCCTCCCAGGTGCCCCAGG - Intergenic
935062999 2:99624057-99624079 CTGCTCCTGCCTGGAGCCACCGG + Intronic
935414634 2:102802589-102802611 CTCCTCCTGCCCCGTGGCATTGG + Intronic
937675278 2:124583429-124583451 CTTCTCAAGCCAGGTGGCATTGG - Intronic
942472007 2:176269854-176269876 CTGCTCCTGCGGGGTGACCTTGG - Intronic
946310293 2:218879401-218879423 GTGCTCCTGCCCTGTGCCCTCGG - Intergenic
948416332 2:237807858-237807880 TTGCTACTTCTAGGTGCCATAGG - Intronic
948484010 2:238268464-238268486 CTGCTCCCGCCAGGGGTCCTCGG + Intronic
948632283 2:239309897-239309919 ATGCTGCTGCCTGGTCCCATGGG + Intronic
948634948 2:239329028-239329050 CTGCTGCTGCCTGGTGGCCTGGG - Intronic
948944984 2:241214949-241214971 CTGCTACTGCCAGGTGCTCTGGG - Intronic
1168880090 20:1199012-1199034 TTGCTTTTGCCATGTGCCATTGG - Intergenic
1170581954 20:17705941-17705963 CTGCTCCTGTGAGGGCCCATGGG + Intronic
1170952257 20:20947592-20947614 ATGCTTCTCCCAGGTGCCCTGGG + Intergenic
1173048732 20:39538239-39538261 CTGTTCTTGCCTGGTCCCATAGG - Intergenic
1177135770 21:17304212-17304234 CTGCTCCTGTGAGGAGCAATAGG - Intergenic
1177355265 21:19998782-19998804 CATCTCCTGCCAGGAGTCATGGG + Intergenic
1179412978 21:41176339-41176361 CTGCTCTTTCCAGGAACCATCGG - Intronic
1179427305 21:41291882-41291904 CTGGCCATGCCAGCTGCCATGGG + Intergenic
1179994438 21:44967474-44967496 CAGCTCCTGCCGGGTCCCACTGG + Intronic
1180134559 21:45853892-45853914 CGGCTCCTGCCCCGTACCATCGG - Intronic
1180957495 22:19747465-19747487 CAGCTCCTGCCAGTTGCCAAGGG - Intergenic
1182010289 22:26995071-26995093 CATCTCCAGCCAAGTGCCATAGG - Intergenic
1182355137 22:29719551-29719573 CTGCTCCTGCCCTGTGACCTTGG + Intergenic
1183726141 22:39590678-39590700 CTGCCCCTGCCACATACCATGGG + Intronic
950062200 3:10080994-10081016 CTGCTCCTACCTGGTGACACAGG + Intronic
951362641 3:21742670-21742692 CTGCTCCTGCCAGGAGGCCCTGG + Intronic
953930184 3:47002117-47002139 CTGCTCCTGGCTGGTGCCACTGG + Exonic
954154707 3:48679045-48679067 CTGCACCTGCCAGGTGGGGTGGG - Exonic
954285696 3:49617487-49617509 CTGCTCCTCCCAGCAGCCATGGG - Intronic
954826701 3:53379871-53379893 CCGCTCCTGCCACTTGCCTTGGG - Intergenic
956093039 3:65688134-65688156 CTGTTCCTGCCAGGGTCCATGGG + Intronic
957216400 3:77325464-77325486 CTGCTGCTGTCTGGTGCCATGGG + Intronic
958033787 3:88147424-88147446 CTGCTCCTTCAACTTGCCATAGG - Intronic
960553006 3:118997069-118997091 CTCCTACTACCAGTTGCCATAGG - Intronic
961158346 3:124700228-124700250 CTGCACCTGCCAAGTTCCCTGGG + Intronic
961514008 3:127421683-127421705 CTGCTCCTGCCCCCTGCCCTGGG - Intergenic
961514087 3:127422299-127422321 ATGCTCCTGGCATGTGCCATGGG - Intergenic
961782495 3:129328844-129328866 CTGCTCCTGCCCTGTCCCACAGG + Intergenic
962212079 3:133487455-133487477 CGGCTCCTGCCAGCTTCCACCGG + Intergenic
965192531 3:165549812-165549834 CTGTGGCTGCCAGGTGCCACTGG + Intergenic
968142551 3:196270674-196270696 CTGGTTTTGCCAGATGCCATTGG - Intronic
968543115 4:1178284-1178306 TTGCTCCGGCCAGGCACCATGGG + Intronic
968567472 4:1321760-1321782 CTGCCCCTGCCAGAGACCATGGG + Intronic
968793359 4:2684944-2684966 CTGCTCCTTCCACGTGGCCTAGG + Intronic
968947612 4:3673832-3673854 CTGCACCTGCCAGGTGACCATGG - Intergenic
969638888 4:8385053-8385075 TGGCCCCTGCCAGGTGGCATGGG + Intronic
971449209 4:26784445-26784467 GGGCTCCTGCCAAGTGCCTTGGG - Intergenic
974460527 4:62181600-62181622 CTGCTGCTGCAAGCTGCCAATGG + Intergenic
976031305 4:80757956-80757978 ATGCTCCTGCCAGGTTCCAAAGG - Intronic
976756211 4:88500457-88500479 CTGCTTCTGTCAGATCCCATTGG + Intronic
978274157 4:106928840-106928862 CTGCAGTTGCCAGTTGCCATTGG + Intronic
980007872 4:127561825-127561847 CTGCCCTTGCTAGGTGCCCTCGG + Intergenic
980654184 4:135760349-135760371 CTTCTCCTTCCTGCTGCCATGGG - Intergenic
983739664 4:171113714-171113736 CTGCTCCTGCAGGGTGGCCTAGG - Intergenic
985744758 5:1640009-1640031 TGGCTCCTGCCAGCTGCCCTGGG - Intergenic
985925525 5:3013094-3013116 TTGCCACTGCCAGATGCCATTGG + Intergenic
986098789 5:4586343-4586365 CTCCACCTGGCAGGTGCCCTGGG + Intergenic
986209673 5:5659155-5659177 CAGCTACTGGCAGGTGCCAAGGG + Intergenic
988538606 5:32089807-32089829 CTTCTCCTGACAGTTGCCCTGGG - Exonic
988702026 5:33685145-33685167 CTGCCCCTGCCAGGGGCCCAGGG - Intronic
992645049 5:78803980-78804002 CTGGCTCTGCCAGGTGCCCTCGG - Intronic
992889240 5:81188785-81188807 CTGCTGCTGCCATTTGCTATCGG - Intronic
995205608 5:109476397-109476419 CTGGTCCTGGCAGGTGGCAGTGG + Intergenic
996033403 5:118731782-118731804 CTTCCAGTGCCAGGTGCCATAGG + Intergenic
996759773 5:126975588-126975610 CTGCTAATGCCAGATGCCCTGGG + Intronic
997251465 5:132391865-132391887 CTCCTCCTGCCACATCCCATGGG - Intronic
997821358 5:137068994-137069016 CAGCTCTTATCAGGTGCCATGGG + Intronic
997825599 5:137104267-137104289 CTGCTCCTGCCATGTAAGATGGG + Intronic
998014949 5:138724632-138724654 CTGTCCCTGCCAGTTGCCAGTGG - Intronic
1000053064 5:157578534-157578556 CTGCCCCTGCCCAGTGCCTTGGG - Intergenic
1002062349 5:176633000-176633022 CAGCTCCTGCCAAGGACCATTGG + Intronic
1002088411 5:176790382-176790404 CTCCTCCTGCCAGCTCCCATTGG - Intergenic
1002552714 5:180008281-180008303 CTACTCCAGCCAGGCGCCAAGGG + Intronic
1003224636 6:4192386-4192408 CTGCTCCAGCCTGTTGCCACAGG - Intergenic
1004265259 6:14143853-14143875 CTGCTGCTGCCAGGAGCTCTCGG - Intergenic
1005882969 6:30074517-30074539 CCGCTCCTGCCTGGGGCCTTGGG + Intronic
1007006839 6:38372060-38372082 CCACTCCTCCCAGGTCCCATGGG + Intronic
1007947779 6:45841321-45841343 CTCCCCATGCCAGGTGCCCTAGG - Intergenic
1010157710 6:72814023-72814045 CTGATCCTGCCTGGCCCCATAGG - Intronic
1012909880 6:105106507-105106529 TTGCTCCTGCCAGATGGCAGGGG + Intronic
1013687861 6:112606835-112606857 CTGCTCCTGCCAGGTTGCCATGG + Intergenic
1018741733 6:166734166-166734188 AAGCTCCTGCCAGGAGCCCTCGG - Intronic
1020087812 7:5320944-5320966 ATGCCCCTGCCCTGTGCCATCGG + Intronic
1022015362 7:26344705-26344727 GAGCTCCTGCTATGTGCCATGGG - Intronic
1022448807 7:30494528-30494550 CTGCTTCTGCCGGGAGCCACTGG + Intergenic
1023683739 7:42714718-42714740 CAGCTACTGCCAGGTGAGATGGG - Intergenic
1023853426 7:44163814-44163836 CTGCTCCAGCCAGCTGCTCTAGG - Intronic
1026880223 7:73903026-73903048 CCGGTGTTGCCAGGTGCCATGGG - Intergenic
1029033460 7:97493003-97493025 CTGGTTCTGCCAGGTGACCTTGG - Intergenic
1033613136 7:142984814-142984836 CTCCTCCTGCCAGGTTCCAGAGG + Intergenic
1033645557 7:143300367-143300389 TTGCTCCTCTCAGGTGCTATTGG + Intronic
1034272897 7:149811962-149811984 GTGGCCCTGCCCGGTGCCATCGG + Intergenic
1034530965 7:151696319-151696341 CTGATGCTACCAGTTGCCATTGG - Intronic
1034974477 7:155439825-155439847 CTGCTCCTGCCAGGTCACAAGGG - Intergenic
1035180956 7:157089348-157089370 CCCCTCCTGCCTGGTGTCATGGG - Intergenic
1035481811 7:159192817-159192839 CTGCAACTGCCAGGTCCCCTGGG - Intergenic
1036190298 8:6663928-6663950 CTGCTTCTTCCAGGTGCCTAAGG - Intergenic
1036205845 8:6805331-6805353 CTTCTCCTGCCAGGTCCCTGGGG + Intergenic
1042748897 8:72136620-72136642 CTGCTACTTACAGGTGCCACAGG + Intergenic
1042939729 8:74095579-74095601 CTGCTGCTGCAAGGTGAGATGGG - Intergenic
1045646446 8:104304411-104304433 CTTCTTCTGCCTTGTGCCATGGG - Intergenic
1046631483 8:116626571-116626593 CTGTTCCTGCCAGGTGACTGAGG + Intergenic
1047673646 8:127175729-127175751 CTGCTCTTTCCAGGTCCCACTGG - Intergenic
1048328072 8:133453736-133453758 CTGCTCCTGCCCCCTGCCACGGG - Intergenic
1048422849 8:134294435-134294457 CTGCTCCAGGCAGGGGCCCTTGG - Intergenic
1048490102 8:134884473-134884495 GAGCTCCTGCCAGGTGCAAGAGG + Intergenic
1049277623 8:141727847-141727869 CTACTCCTGCTCGGTGCCAGTGG + Intergenic
1052607875 9:30728715-30728737 TTGCTTCTGCCACATGCCATTGG - Intergenic
1053168117 9:35859008-35859030 CTGCCCCTGTCAGCTGGCATAGG - Intergenic
1053426490 9:38013702-38013724 TTGCCCCTGCCTGGTGCCTTAGG - Intronic
1058190412 9:101907780-101907802 CTGGTCCTGCCTCATGCCATTGG - Intergenic
1060794984 9:126507317-126507339 CAGCTCCTGCCAGGTGGCCCCGG + Intergenic
1060831245 9:126718769-126718791 TTGCTTCTGCCAGGAGCCAAGGG + Intergenic
1061160798 9:128892717-128892739 CTGCTCCCACCACGGGCCATGGG - Intronic
1062007147 9:134245274-134245296 GTGCACCTGCCATGTGCCAGGGG - Intergenic
1062275801 9:135729998-135730020 CTGCACCTCCCAGGTCCCAGTGG - Intronic
1062389431 9:136328029-136328051 GTGCCCCTGCCAGGTGCCAGGGG - Intronic
1185778478 X:2825367-2825389 CTCCATCTGCCGGGTGCCATTGG - Intergenic
1186719016 X:12282521-12282543 CTGCAGCTGCCACGTGCCACAGG - Intronic
1189481666 X:41396674-41396696 CTGGTCCTGACAGCTGCCTTTGG - Intergenic
1190561102 X:51686082-51686104 CTGCTTCTGCCAGGTGACCAAGG - Intergenic
1190563189 X:51707235-51707257 CTGCTTCTGCCAGGTGACCAAGG + Intergenic
1192340247 X:70258271-70258293 CTGTTCCTTCCTGGGGCCATTGG - Exonic
1192759837 X:74085754-74085776 CTGCTGCTGCAAGCTGCTATGGG + Intergenic