ID: 1072612857

View in Genome Browser
Species Human (GRCh38)
Location 10:97030747-97030769
Sequence GGGTACTCACAGGTGAGACA GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 153
Summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 145}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1072612853_1072612857 -6 Left 1072612853 10:97030730-97030752 CCCAGAGAAAGGGGCTAGGGTAC 0: 1
1: 0
2: 1
3: 16
4: 147
Right 1072612857 10:97030747-97030769 GGGTACTCACAGGTGAGACAGGG 0: 1
1: 0
2: 1
3: 6
4: 145
1072612849_1072612857 3 Left 1072612849 10:97030721-97030743 CCAAAGAGGCCCAGAGAAAGGGG 0: 1
1: 0
2: 3
3: 29
4: 329
Right 1072612857 10:97030747-97030769 GGGTACTCACAGGTGAGACAGGG 0: 1
1: 0
2: 1
3: 6
4: 145
1072612854_1072612857 -7 Left 1072612854 10:97030731-97030753 CCAGAGAAAGGGGCTAGGGTACT 0: 1
1: 0
2: 1
3: 9
4: 123
Right 1072612857 10:97030747-97030769 GGGTACTCACAGGTGAGACAGGG 0: 1
1: 0
2: 1
3: 6
4: 145
1072612846_1072612857 14 Left 1072612846 10:97030710-97030732 CCTGTTGAAATCCAAAGAGGCCC 0: 1
1: 0
2: 0
3: 11
4: 80
Right 1072612857 10:97030747-97030769 GGGTACTCACAGGTGAGACAGGG 0: 1
1: 0
2: 1
3: 6
4: 145
1072612844_1072612857 20 Left 1072612844 10:97030704-97030726 CCAAGTCCTGTTGAAATCCAAAG 0: 1
1: 0
2: 2
3: 20
4: 260
Right 1072612857 10:97030747-97030769 GGGTACTCACAGGTGAGACAGGG 0: 1
1: 0
2: 1
3: 6
4: 145

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1072612857 Original CRISPR GGGTACTCACAGGTGAGACA GGG Exonic
902654602 1:17858892-17858914 GGGGAGTCAGAGCTGAGACATGG + Intergenic
903540106 1:24092072-24092094 GGGTTCTCTGAGGTCAGACATGG + Intronic
907183010 1:52587334-52587356 TGGTACTCACAGATGGTACAAGG + Intergenic
909180160 1:72413743-72413765 GGGCACTCACACATGACACATGG + Intergenic
911930865 1:103901885-103901907 GGGTGCACAGAGGAGAGACATGG + Intergenic
915449554 1:155995092-155995114 GGGTGGGCACAGCTGAGACAAGG - Intronic
921779245 1:219141933-219141955 GGGTAATCACAGGGGAGGCAGGG - Intergenic
924701780 1:246461926-246461948 AGGTACTCACAGTTTAGAAAAGG + Intronic
924954442 1:248913197-248913219 GGGTACCCACAGGGGAGGGAGGG - Intronic
1064584266 10:16823537-16823559 AGGTAAACACAGGTGAGACTTGG + Intergenic
1067440758 10:46308142-46308164 GTGTCCTCACAAGTGAGACTGGG - Intronic
1070150832 10:73803882-73803904 GGGTATTGACTGGTGAGACTGGG - Exonic
1071399012 10:85251208-85251230 GTGAACTCACCGGTGAGCCAGGG - Intergenic
1072612857 10:97030747-97030769 GGGTACTCACAGGTGAGACAGGG + Exonic
1073951087 10:108810703-108810725 TGGTACTCAAAGGGGTGACATGG + Intergenic
1074192506 10:111150095-111150117 GGCTGCTCCCAGGTGAGCCACGG - Intergenic
1078491725 11:11775613-11775635 GGGTCCTCACAGGAAAAACAGGG + Intergenic
1079241346 11:18724252-18724274 GGGCACTCACCTGTGAGACTGGG + Exonic
1081998319 11:47378299-47378321 CGGTACTCACAGGGGGGACGAGG + Exonic
1084448628 11:69218964-69218986 GGGTACCCACTAGTCAGACAGGG - Intergenic
1084448650 11:69219109-69219131 GGGTACTCACTAGCCAGACATGG - Intergenic
1087040388 11:93793405-93793427 GTGTACTCACAGGGCAGGCATGG - Intronic
1087138870 11:94746378-94746400 GGTTATTCACAGGGCAGACATGG - Intronic
1089131283 11:116214293-116214315 GGATACTCCAAGGTGAGACCTGG + Intergenic
1090872490 11:130760790-130760812 AGCTACTCAAAGGTGAGAAAGGG - Intergenic
1091904565 12:4173915-4173937 TGGTACCCATAGGTGAGGCACGG - Intergenic
1092104615 12:5912646-5912668 GGGACCGCACAGCTGAGACAGGG - Intronic
1102243164 12:111338214-111338236 GCCTACTCCCAGGAGAGACATGG - Intronic
1102381056 12:112467197-112467219 GGGTACTCACATGTACAACATGG + Intronic
1104338816 12:127928097-127928119 GGGTCCTCACAGGAAACACATGG + Intergenic
1105607940 13:21942718-21942740 AGGCAGTTACAGGTGAGACAGGG - Intergenic
1111253985 13:85641689-85641711 GGGCACCCACAGGTAACACACGG - Intergenic
1120434647 14:84465898-84465920 GTGTACAAACAGGTGACACATGG - Intergenic
1123056570 14:105573817-105573839 GGGCACACACCGGTGAGCCAGGG - Intergenic
1123081641 14:105697968-105697990 GGGCACACACCGGTGAGCCAGGG + Intergenic
1127304400 15:57690778-57690800 GGGTGCTCACAGTGGACACATGG - Intronic
1129461161 15:75700663-75700685 GGGAACTCAGAGATGAGCCATGG - Intronic
1129723669 15:77891079-77891101 GGGAACTCAGAGATGAGCCATGG + Intergenic
1134694642 16:16214492-16214514 GGGTGCTCAGAGGAGAGAAAAGG + Intronic
1134977193 16:18580145-18580167 GGGTGCTCAGAGGAGAGAAAAGG - Intergenic
1135547324 16:23374991-23375013 GTTTACTCATAGGTGAAACAGGG - Intronic
1139268209 16:65659191-65659213 GGTGATTCACTGGTGAGACAGGG + Intergenic
1139706925 16:68747245-68747267 GGGTACCCAAAGGTGTGGCAGGG + Intronic
1140827071 16:78716535-78716557 GAGTACACACAGGTGACATAGGG - Intronic
1141356843 16:83354736-83354758 CGGTAGTACCAGGTGAGACAGGG + Intronic
1142038080 16:87874784-87874806 GGGGACTCACAGGAGAGAGGCGG - Intergenic
1142225251 16:88874014-88874036 GGGTACACACAGGTGTACCAGGG - Intergenic
1145913982 17:28560038-28560060 GTGGACTCTCAGGTGAGACCGGG - Exonic
1146938478 17:36827073-36827095 GGGAACTCAGTGTTGAGACAGGG - Intergenic
1148123819 17:45226815-45226837 GGGTCCCCACAGCTGGGACAAGG - Intronic
1148796208 17:50198151-50198173 GGATACTCACAGGTGCACCAGGG + Exonic
1151426723 17:74035497-74035519 TGGTACTCACAGGGGCCACACGG + Intergenic
1152459709 17:80435420-80435442 GGCTACTCACAGGTATGACATGG - Intronic
1152671010 17:81606254-81606276 GGCTACTCAGAGGCGGGACAAGG + Intronic
1153528832 18:6022995-6023017 GGTTACTCACTGGTAAAACAAGG + Intronic
1153715463 18:7843281-7843303 GGAGACTCTCAGGAGAGACAGGG - Intronic
1155144841 18:23074882-23074904 GGCTATTCACAGGTGGGTCATGG + Intergenic
1157439013 18:47696221-47696243 AGGAACAAACAGGTGAGACAGGG - Intergenic
1158927193 18:62279733-62279755 GGGTATTCACAGGTGATGCACGG - Intronic
1163506634 19:17711162-17711184 GGGTACTCACCGGAGAGACAGGG + Intergenic
1163741806 19:19018878-19018900 CTGTAGTCACAGGTGAGAGAAGG + Intronic
1164687696 19:30179027-30179049 AGGCACTCACAGGGAAGACAGGG + Intergenic
1164802859 19:31092093-31092115 AGAGACTGACAGGTGAGACAGGG - Intergenic
1166905772 19:46107423-46107445 GGGTCCGCACAGATGGGACATGG + Intergenic
1168327442 19:55545488-55545510 GGGGACCCAGAGGTGAGAGACGG - Exonic
925297775 2:2789610-2789632 TGGTGCTCACAGGTGGGAAAGGG + Intergenic
926197143 2:10770948-10770970 GGGGATTCAGAGGTGAGCCAGGG + Intronic
926906846 2:17813833-17813855 GGGAACTCCCAGGGGACACAAGG - Intergenic
927417790 2:22897099-22897121 TGGAACTCACATGTGATACAGGG - Intergenic
927706003 2:25296936-25296958 AGGTCCTGACAGGTGTGACAGGG - Intronic
927711477 2:25328910-25328932 GGGTGGTCACAGGCCAGACAAGG - Intronic
928281354 2:29949156-29949178 AGGTACTGACAGCTCAGACAGGG + Intergenic
931931570 2:67142822-67142844 AAATACTCACAGGTGGGACAAGG + Intergenic
933507685 2:83199548-83199570 TGGTACTCACAGTTGACAAAAGG - Intergenic
935806185 2:106750038-106750060 GGGCTCTGACAGGTGAGAGAGGG - Intergenic
936394598 2:112112770-112112792 GGGTATCCACAGGTGACAGAAGG - Intronic
936651679 2:114434574-114434596 GGGTCATCAAAAGTGAGACATGG - Intergenic
938732699 2:134158703-134158725 GGGGAGGCACAGGTGGGACAGGG - Intronic
939152968 2:138494797-138494819 GGGTCCTCAGAGGTGGAACAAGG + Intergenic
940151038 2:150600844-150600866 GGGAACTCACAGGGGCTACAAGG + Intergenic
940805491 2:158182100-158182122 GGGAACTCACATGAGAAACAGGG + Intronic
1169414635 20:5405411-5405433 GGGAACTCCCAGGGGAGAAAGGG - Intergenic
1171483330 20:25469309-25469331 GGGTACTCACCAGTGAGAGTCGG - Intronic
1171538026 20:25915319-25915341 TGTTACTCACACGTGAAACATGG - Intergenic
1172313675 20:33936971-33936993 GGGAACTCAAATCTGAGACAGGG - Intergenic
1173198067 20:40932377-40932399 GGCTATTCCCAGGTGAGCCAAGG + Intergenic
1174405461 20:50300070-50300092 GGGTACTAATAGGAGTGACAAGG + Intergenic
1174682760 20:52424132-52424154 GGGTAGGCACAGGTGAGTGAAGG - Intergenic
1175816961 20:61888185-61888207 CGGTACACACAGATGGGACATGG + Intronic
1179062310 21:37990283-37990305 CGGAACTCAGAGGTGAGTCAGGG - Intronic
1179708702 21:43197478-43197500 GGGGAGGCAGAGGTGAGACAGGG + Intergenic
1182575761 22:31271905-31271927 TGGAACTCAGAGGTGGGACAGGG - Intronic
1184924437 22:47626986-47627008 GGGTACACAGAGGGGACACACGG + Intergenic
1185322128 22:50206376-50206398 GGGGACTCCCAGGTGGAACATGG - Exonic
949144556 3:681839-681861 GGATATTCACAGTTGAAACAGGG - Intergenic
959260952 3:104078799-104078821 GGGCTCTCACAGGTGAAACCTGG + Intergenic
961107881 3:124257709-124257731 GGGTGAGCACAGGGGAGACAGGG + Intronic
968726976 4:2252320-2252342 GGGTGCTCACAGGTGACCCTGGG - Intronic
970142470 4:12997117-12997139 GGGTACCCTATGGTGAGACAGGG + Intergenic
970303882 4:14710610-14710632 GGGTAATCACAGTTGAGTGAGGG - Intergenic
972401676 4:38710055-38710077 GGCTACCCACAGATGAGCCAGGG - Intergenic
974286066 4:59868932-59868954 ATGTTCTCACAGGAGAGACATGG + Intergenic
975384454 4:73739485-73739507 GGGTCCTCAGAGGTCAGACTTGG + Intergenic
976032945 4:80779665-80779687 GGGGACTGACAGTGGAGACAGGG - Intronic
978161351 4:105552236-105552258 AGTTACTCACAGGTGACCCACGG - Intergenic
978403195 4:108352274-108352296 GGGTACTATGAGATGAGACAGGG + Intergenic
982119883 4:152132569-152132591 AGGTGCTCACAGGTAAGACTGGG - Intergenic
984579997 4:181500953-181500975 GGGTACTGACAGGTGGGGCAGGG - Intergenic
985683377 5:1268641-1268663 GGGAAGACACAGGTGAGAGACGG + Intronic
992672320 5:79072710-79072732 GTATAATCACAGGTGAGACTGGG + Intronic
995688255 5:114795108-114795130 GGGTTCTCAAAGGTGAGATGTGG + Intergenic
997427302 5:133812209-133812231 GGGTCCTCCCAGGCAAGACATGG - Intergenic
998099421 5:139419634-139419656 GGGCACTGACTGGTGAGACTGGG + Intronic
1002484799 5:179527522-179527544 GGTTACTCAGAGGTGTGCCATGG + Intergenic
1007178926 6:39914626-39914648 GGGTGGTCACCTGTGAGACAGGG + Intronic
1013399728 6:109781037-109781059 GGGAACTCACATATCAGACAGGG - Intronic
1013631472 6:111990067-111990089 GGGTGTTCACAGGTGAGAAGGGG + Intergenic
1015509172 6:134020735-134020757 GGGTAATCACACGTGAGGCTTGG - Intronic
1015522780 6:134148011-134148033 GGCTACTTCCAGGGGAGACAAGG - Intergenic
1018686623 6:166308415-166308437 GGGTCCCCACAGCTGAGACGCGG + Intronic
1019172787 6:170143627-170143649 GGGCTCTCACAGCTGAGCCACGG - Intergenic
1019537677 7:1537688-1537710 AGGGCCGCACAGGTGAGACAGGG - Intronic
1019811616 7:3169206-3169228 GGGAAAGCACAGGTGAGGCAGGG - Intronic
1021410222 7:20321701-20321723 GGGTAAACACAGTTGAGAAAGGG + Intergenic
1024098551 7:46006026-46006048 CTGTCCTCACAGGTGAGAGAGGG - Intergenic
1028147617 7:87335761-87335783 TGGAACTCACAGGCTAGACAGGG - Intergenic
1030406062 7:109115026-109115048 GGGTACTTGCAAATGAGACAGGG + Intergenic
1031675333 7:124603231-124603253 GGCTTCTTACAGATGAGACAAGG + Intergenic
1033026447 7:137777993-137778015 TGGCAATCACAGGTAAGACATGG + Intronic
1033431351 7:141292583-141292605 GGGTATTCAAAGGTGAAATATGG - Intronic
1034548757 7:151807025-151807047 GGATACACAAAGGTAAGACATGG + Intronic
1037824647 8:22154132-22154154 ACGTACTCACAGGTGAGTCAAGG + Exonic
1040776250 8:51046302-51046324 GCGTGATCACAGGTGGGACAAGG + Intergenic
1040918332 8:52587069-52587091 GCGAACTCGCAGGTGAGAGAGGG - Intergenic
1044738524 8:95302701-95302723 GGTTCCTCAAAGCTGAGACAGGG - Intergenic
1046578161 8:116057934-116057956 GGGTCCTGACAAGTGAGAGAGGG - Intergenic
1051400130 9:16672101-16672123 AGATAATCACAGGTGAAACAGGG + Intronic
1053054189 9:34984302-34984324 GGTTACTCAAAGGTGGGACAAGG - Intergenic
1053146515 9:35715672-35715694 GTGTATTCACAGGGGAGACCAGG + Intronic
1056924675 9:90823053-90823075 GGGAATTCCCAGCTGAGACAAGG - Intronic
1057140994 9:92726718-92726740 GGGGACCCTCAGGAGAGACAGGG + Intronic
1058734827 9:107884594-107884616 GGGTCCTCACAGGAGTGGCATGG - Intergenic
1061940319 9:133880418-133880440 GGGAACTCCCAGGTCAGAAAAGG + Intronic
1185847242 X:3449321-3449343 GGGTCCTCAAATGTCAGACAAGG - Intergenic
1186828743 X:13368699-13368721 AGATACTCACAGAAGAGACAGGG - Intergenic
1187225289 X:17370188-17370210 TGGTTCTCACAGGTTAGAAACGG - Intergenic
1188464772 X:30467432-30467454 GGGTTCCCACAGGAAAGACATGG - Intergenic
1190029589 X:46959212-46959234 AGGAACACACAGGTGAGAAAAGG - Intronic
1194811053 X:98387707-98387729 GGTCACTCACAGCTGAGAGATGG + Intergenic
1195560424 X:106276709-106276731 GGGTACTTACATCTGAGAAAGGG - Intergenic
1195561538 X:106289630-106289652 GGGTACTTACATCTGAGAAAGGG + Intergenic
1200624019 Y:5490291-5490313 GTGTACTCACAGGGAAGAAAGGG + Intronic
1200801708 Y:7393078-7393100 GGGAAATGACAGGTAAGACAGGG + Intergenic