ID: 1072613095

View in Genome Browser
Species Human (GRCh38)
Location 10:97031892-97031914
Sequence TGTCCCTATTTTACAGTCGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 166
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 148}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1072613095_1072613099 -1 Left 1072613095 10:97031892-97031914 CCCCCGACTGTAAAATAGGGACA 0: 1
1: 0
2: 0
3: 17
4: 148
Right 1072613099 10:97031914-97031936 AAAAATAATGCCAACTCCATAGG No data
1072613095_1072613103 10 Left 1072613095 10:97031892-97031914 CCCCCGACTGTAAAATAGGGACA 0: 1
1: 0
2: 0
3: 17
4: 148
Right 1072613103 10:97031925-97031947 CAACTCCATAGGGCTGTCCTGGG No data
1072613095_1072613106 23 Left 1072613095 10:97031892-97031914 CCCCCGACTGTAAAATAGGGACA 0: 1
1: 0
2: 0
3: 17
4: 148
Right 1072613106 10:97031938-97031960 CTGTCCTGGGGACGAAATCCAGG No data
1072613095_1072613104 11 Left 1072613095 10:97031892-97031914 CCCCCGACTGTAAAATAGGGACA 0: 1
1: 0
2: 0
3: 17
4: 148
Right 1072613104 10:97031926-97031948 AACTCCATAGGGCTGTCCTGGGG No data
1072613095_1072613102 9 Left 1072613095 10:97031892-97031914 CCCCCGACTGTAAAATAGGGACA 0: 1
1: 0
2: 0
3: 17
4: 148
Right 1072613102 10:97031924-97031946 CCAACTCCATAGGGCTGTCCTGG No data
1072613095_1072613100 0 Left 1072613095 10:97031892-97031914 CCCCCGACTGTAAAATAGGGACA 0: 1
1: 0
2: 0
3: 17
4: 148
Right 1072613100 10:97031915-97031937 AAAATAATGCCAACTCCATAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1072613095 Original CRISPR TGTCCCTATTTTACAGTCGG GGG (reversed) Intronic
900660061 1:3777743-3777765 TGTCCCAGTTCTACAGTCAGAGG + Intergenic
901152363 1:7112432-7112454 TTTCCCCATTTTACAGACAGAGG + Intronic
902554035 1:17236301-17236323 TGTCCCCATTTTACAGGTGAGGG - Intronic
902700811 1:18170597-18170619 TGTCCCCATCTTACAGATGGAGG + Intronic
903538092 1:24080614-24080636 TATCCCCATTTTACAGACGAGGG - Intronic
905260051 1:36710751-36710773 TGTCCCCATTTTACAGATGAAGG + Intergenic
905280278 1:36844624-36844646 TTTCCCCATTTTACAGAAGGAGG - Intronic
905791674 1:40792807-40792829 TCGCCCTATTTTACAGACAGGGG + Intronic
905799058 1:40831881-40831903 TGTCCCCACTTTACAGACGTGGG + Intronic
905802776 1:40856038-40856060 TGTCTCTATTTGACAGACGAGGG + Intergenic
907044737 1:51293860-51293882 TGTCTCCATTTTACAGATGGGGG - Intronic
907526132 1:55055193-55055215 TGTCCCTGTTTCACAGAGGGCGG + Intronic
907595149 1:55712820-55712842 TGTCCCCATTTTACAGGCAAGGG - Intergenic
907758967 1:57338967-57338989 TATCCCTATTTTACAGAGGAGGG - Intronic
908427277 1:64019385-64019407 TCTCCCCATTTTACAGATGGGGG - Intronic
916497415 1:165357613-165357635 TGTCCCAATCTTACAGTTGAGGG + Intergenic
917458449 1:175205926-175205948 TATCCCCATTTTACAGACTGGGG + Intergenic
919227361 1:194723195-194723217 TGTCCCTATTTTACAGCAAGGGG + Intergenic
919851870 1:201678439-201678461 TGTCCCCATTTTACAGATGAGGG + Intronic
920934580 1:210419139-210419161 TCTCCCTATTTTACAGATGAGGG - Intronic
1064799896 10:19058127-19058149 TGTTCCTATTTTACGGTTTGAGG + Intronic
1065146516 10:22773698-22773720 TATCCCCATTTTACAGTTGAAGG - Intergenic
1065760832 10:28981872-28981894 TGTCCATATTTTACAGTGGTAGG + Intergenic
1067987012 10:51160729-51160751 TCTCCCTTTTTTACTGTTGGGGG + Intronic
1068887397 10:62111646-62111668 TTTCCCCATTTTACAGACGAAGG + Intergenic
1069963467 10:72093430-72093452 TGTCCCCATTTTACAAACTGAGG - Intergenic
1071238594 10:83678580-83678602 TCTCTCTATTTTAGAGTCTGTGG - Intergenic
1072613095 10:97031892-97031914 TGTCCCTATTTTACAGTCGGGGG - Intronic
1073433225 10:103500328-103500350 TGTCACTGTTTTACAGATGGGGG + Intronic
1075397025 10:122134755-122134777 TGCTCCCATCTTACAGTCGGGGG + Intronic
1075664934 10:124223359-124223381 TATCCCCATTTTACAGTGGAGGG + Intergenic
1075834076 10:125438211-125438233 TGTCCCTGTTTTAAACTGGGTGG + Intergenic
1075902532 10:126054703-126054725 TGTCCCCATTTTACAGATGAGGG - Intronic
1075925550 10:126249059-126249081 TATCCTTACTTTACAGTTGGAGG + Intronic
1086042592 11:82496770-82496792 TGTCCCCATTTTACAGATTGAGG + Intergenic
1089611997 11:119674494-119674516 TGTCCCCGTTTTACAGATGGTGG + Intronic
1089658736 11:119971749-119971771 TATCCCCATTTTACAGGCAGAGG - Intergenic
1089845902 11:121458060-121458082 TGTCCCTCCATTACAGTGGGTGG - Intronic
1091819324 12:3463143-3463165 TATCCCCATTTTACAGACTGAGG + Intronic
1094179747 12:27579628-27579650 TATACCTATTTTACAGTTGCTGG + Intronic
1095338879 12:41064820-41064842 TATCCCTATTTTATAGTTGAAGG + Intronic
1099016474 12:77349334-77349356 TATCCTTATTTTACAGTTGAAGG + Intergenic
1100325983 12:93540271-93540293 TATCCCTATGTTACAGTCAATGG - Intergenic
1102540953 12:113618920-113618942 TGTCCCCATTTTACAGATGGGGG + Intergenic
1102558885 12:113748179-113748201 TGTCCCCATTTTACAGATGAGGG - Intergenic
1102928852 12:116847407-116847429 TATCCCCATTTTACAGATGGGGG + Intronic
1104368228 12:128197283-128197305 TGTCCTTATTTAACAGTCAAAGG + Intergenic
1108283437 13:48882045-48882067 TGTCCCCATTTTATAGATGGGGG - Intergenic
1109761569 13:66836762-66836784 TTTCCGTATGTTACAATCGGTGG + Intronic
1111926397 13:94467947-94467969 TGTCCTTATTTTTCAGTCAAAGG - Intronic
1116307267 14:43274188-43274210 TGTCCCTAGTTGACAATTGGGGG - Intergenic
1117547409 14:56804782-56804804 TGTCCCCATTTTAAAGATGGAGG - Intronic
1118021421 14:61719431-61719453 TGTCCCTATTTTACAAATGAGGG - Intronic
1119582022 14:75793585-75793607 TCTCCCCATTTTACAGATGGGGG + Intronic
1119735600 14:76979721-76979743 TTTCCCTATTTTACAGATGAGGG - Intergenic
1123880682 15:24675830-24675852 TGACCCTGTTTTACGGTAGGAGG + Intergenic
1124121872 15:26894732-26894754 TGTCCCTATTTTGCAGGTGATGG + Intronic
1126232223 15:46340189-46340211 TGTCCCCATTTTACAGGTAGAGG - Intergenic
1128148571 15:65346829-65346851 TTTCCCTATTTTACAGAGGAGGG - Intronic
1128645196 15:69373206-69373228 TCTCCCTATTTTAAGGTCAGTGG + Intronic
1130878866 15:88037863-88037885 TTTCCCCATTTTAAAGACGGGGG + Intronic
1132724102 16:1331440-1331462 TGTCCCCATTTTACAGAAGAGGG + Intergenic
1133211925 16:4268075-4268097 TTTCCATATTTTACAGACGGAGG - Intronic
1134791339 16:16991891-16991913 TATCCTTATTTTACAGATGGAGG + Intergenic
1135179176 16:20258014-20258036 TGTACCTATTTTACAGATGAGGG - Intergenic
1137699407 16:50485791-50485813 TGTCCCCATTTTACAGAAGTGGG - Intergenic
1140056553 16:71530765-71530787 TTTTCCTTTTTTAGAGTCGGGGG - Intronic
1141339875 16:83193284-83193306 TATTCCTATTTTACAGTGGAGGG + Intronic
1141663275 16:85453102-85453124 TGCCCCCATTTTACAGGTGGGGG - Intergenic
1141992493 16:87618499-87618521 CGTGCCCATTTTACAGACGGTGG + Intronic
1142701953 17:1668067-1668089 TATCCCTATTTTACAGATGAGGG + Intronic
1143272617 17:5687003-5687025 TATCCCCATTTTACAGCTGGGGG + Intergenic
1144575804 17:16428667-16428689 TATGCCCATTTTACAGTGGGAGG + Intronic
1150179398 17:63100571-63100593 TCTCCCTGTTTTACAGTCAAAGG + Intronic
1151936114 17:77262463-77262485 TGTTCCTATTTAAAAGTTGGAGG + Intergenic
1160474330 18:79168551-79168573 TGTCCCTATTTTAGGCTCAGAGG - Intronic
1162056987 19:8070705-8070727 TATCCCTATTTTACAGATGGAGG - Intronic
1168307653 19:55444051-55444073 TATCCCCATTTTACAGATGGGGG - Intergenic
1168321934 19:55515998-55516020 TATCCCCATTTTACAGAAGGGGG - Intronic
927304828 2:21558941-21558963 TATCCCTATTTTATAGTTAGAGG + Intergenic
929189648 2:39127237-39127259 TTTCCCTTTTTTACAGTTGCTGG - Intergenic
929245386 2:39696520-39696542 TCTCCCTCTTTTACAGACGAGGG + Intronic
929326948 2:40625457-40625479 TATTCCAATTTTACAGTTGGAGG - Intergenic
929694549 2:44103013-44103035 TGTCCCTGTGATACAGTGGGGGG + Intergenic
930242196 2:48947483-48947505 TGTTCCAATTTTACAGTTGAGGG + Intergenic
931767382 2:65468876-65468898 TATCCCTGTTTTACAGACGGAGG + Intergenic
933008030 2:77021304-77021326 TGACCATATTTTACAGACAGAGG + Intronic
937340232 2:121086543-121086565 TGCCCCCATTTTACAGATGGAGG + Intergenic
938180003 2:129172456-129172478 TTTTCATATTTTACAGTAGGAGG - Intergenic
945687007 2:212983824-212983846 TGTCCCTATTTTACAGATAAAGG + Intergenic
1171105613 20:22429912-22429934 TGTCCCTATTATAAAGTGGTGGG + Intergenic
1172286158 20:33741891-33741913 TGTCCCTATTTTACAGGTGTAGG - Intronic
1172618467 20:36305630-36305652 TGTCCCCATTTTACAGGTGGAGG + Intergenic
1174580084 20:51565170-51565192 TGTCCCCATTTTACAGAGTGGGG - Intergenic
1174769322 20:53283712-53283734 TATTCCTATTTTACAGTTGAAGG + Intronic
1175749039 20:61482511-61482533 TGGCCCTCTTTTACTGTGGGTGG + Intronic
1177916633 21:27096563-27096585 TGTAACTATTTTACAGTGGCAGG + Intergenic
1178132117 21:29585553-29585575 TTTCCATATTTTGCAGTCTGAGG - Intronic
1178332724 21:31713342-31713364 TATCCCCATTTTACAGATGGAGG - Intronic
1180624415 22:17184556-17184578 TGTCCTTATTGTAAAATCGGTGG + Intronic
1182552542 22:31107880-31107902 TTTCCCTATCTTAAAGTCGCAGG - Exonic
1183271153 22:36863317-36863339 TGTCCCCATTTTACAGAGGAGGG + Intronic
950123552 3:10497597-10497619 TATCCCCATTTTACAGATGGTGG + Intronic
950542459 3:13620559-13620581 TGGCCTCATTTTACAGTGGGGGG - Intronic
951781127 3:26363710-26363732 TGTCTCCATTTTACAGACGGAGG - Intergenic
952856121 3:37772098-37772120 TGTCCCCATTTTACAGATGGAGG - Intronic
955789663 3:62575570-62575592 TATTCCTATTTTACAGTTGAGGG + Intronic
958068773 3:88581791-88581813 TGTTCCCATTTTACAGACAGAGG + Intergenic
962411758 3:135146988-135147010 TATTCCTATTTTACAGTTGAAGG + Intronic
963117435 3:141742628-141742650 TGTCCCTTTTTTACAGATGAGGG + Intronic
963565113 3:146919631-146919653 AGTCCTTATTTTAAAGTCAGTGG + Intergenic
966732196 3:183160619-183160641 TATCCCTATTTTACAGATGGCGG - Intronic
967441299 3:189512213-189512235 TGCCCCCATTTGACAGTTGGTGG - Intergenic
967925362 3:194641518-194641540 AGTCCCTTGTTTAGAGTCGGAGG + Exonic
969078387 4:4598941-4598963 TGTCCCTTTTTGTCAGTGGGAGG + Intergenic
969237784 4:5878306-5878328 TGTCCCTATTTTACAGAGTGGGG - Intronic
971197809 4:24486207-24486229 TCTCCCCATTTTACAGACGAGGG + Intergenic
976348156 4:84029187-84029209 TGTCCCCATTTTACAGATGAAGG - Intergenic
977891529 4:102317748-102317770 TCCTCCTATTTTACAGTTGGAGG - Intronic
985224083 4:187740425-187740447 TTTCCCTATTTTACTGTTGTTGG - Intergenic
994081814 5:95715886-95715908 TGTCCGTATTTTACATTGAGTGG - Intronic
997302709 5:132818110-132818132 TGTACCTATTTCACAGGCTGTGG + Intergenic
999246785 5:150159254-150159276 TGTCCCCATTTCACAGTTGAAGG - Intergenic
1000142443 5:158418802-158418824 TGTCCCTTTTGTACACTCAGTGG + Intergenic
1001307509 5:170586073-170586095 TATCCCCATTTTACAGATGGGGG - Intronic
1002911957 6:1497424-1497446 TGTCCCTTTTTTTCAGCAGGTGG - Intergenic
1003563426 6:7202595-7202617 TATCCCCATATTACAGTCTGAGG - Intronic
1004169338 6:13283774-13283796 TGTGCCCATTTTACAGGAGGAGG + Intronic
1004270647 6:14192366-14192388 TGCCTCTATTTTACAGCTGGGGG + Intergenic
1008388294 6:50919946-50919968 TGTCCCTTTTTTGCAGTTGCTGG + Intergenic
1012125824 6:95427199-95427221 TGTCCCCATTTTACTGGCGAGGG + Intergenic
1012257890 6:97055333-97055355 TATCCCTCTTTTACAGTGGGAGG + Intronic
1014306786 6:119752918-119752940 TGTCCCTTTTTTACTGTTGTTGG + Intergenic
1014672870 6:124328901-124328923 TGTCCATAATTTACACTCCGTGG + Intronic
1018443274 6:163833013-163833035 TTTCCCTATTTTAAGGTCAGCGG + Intergenic
1020082020 7:5291330-5291352 TGTGCCCATTTTACAGACGAGGG - Intronic
1022318557 7:29266616-29266638 TGACCCCATTTGACAGTCGAGGG + Intronic
1023298538 7:38742500-38742522 TGTCCCCATTTTACAGACAAGGG + Intronic
1024025518 7:45406868-45406890 TGTGCCTATTTTAAGGTGGGAGG - Intergenic
1025196901 7:56940808-56940830 TGTGCCCATTTTACAGACGAGGG + Intergenic
1025675047 7:63636129-63636151 TGTGCCCATTTTACAGACGAGGG - Intergenic
1026404864 7:70054816-70054838 TGTCCTTACTTTTCAGTAGGGGG + Intronic
1028614625 7:92752125-92752147 TGTCCTTATTTTACAGATGGAGG - Intronic
1032344223 7:131105228-131105250 TACCCCTATTTTATAGTTGGAGG - Intergenic
1033988950 7:147261030-147261052 TGTCCACATTTTACAGTCTCTGG + Intronic
1036685874 8:10909874-10909896 TGTCCCTATTTTTCAGAGGAAGG + Intronic
1041653974 8:60330375-60330397 TGTCACTAGTTCACAGTCAGAGG + Intergenic
1043212948 8:77548708-77548730 TGTCCTTTTTTTACAGTAGTTGG + Intergenic
1044593248 8:93934244-93934266 TGACCTTATTTTACAGTCACAGG - Intergenic
1047286311 8:123490206-123490228 TGTGCCTATTTTACAGATGGAGG + Intergenic
1047511822 8:125521459-125521481 TTTCCCTATTTCACAGTCACAGG + Intergenic
1051870565 9:21732786-21732808 TGTCTATATTTTTCAGACGGGGG - Intergenic
1052431602 9:28374085-28374107 TGTCCCAATTTTATAGACGAAGG + Intronic
1057913137 9:99035539-99035561 TTTCCCTATTGCACAGTTGGGGG - Intronic
1059618990 9:115982677-115982699 TATCCCTATTTTACAGTTAAGGG - Intergenic
1060629246 9:125141808-125141830 TGTCACTATTTTACAGAAGAGGG - Intronic
1061292808 9:129661577-129661599 TATTCCTATTTTACAGACGATGG + Intergenic
1061550995 9:131334729-131334751 TGTCTCCATTTCACAGTCCGGGG + Intergenic
1186614553 X:11173045-11173067 TGTCCCTATTTTATAGACGAGGG + Intronic
1186857245 X:13638175-13638197 TCTCCCTATTCTACAGGCTGTGG + Intergenic
1194598342 X:95888067-95888089 TGTCCTCATTTTACAGACGAGGG + Intergenic
1196023510 X:111014962-111014984 TGTCCCAATTTTACAGAAGAGGG - Intronic
1196197039 X:112847355-112847377 TATCCCTATTTTACAGATGAGGG - Intergenic
1196358564 X:114824591-114824613 TGACCCTAATTTAAAGTCAGTGG - Intronic
1196634290 X:117983181-117983203 TTTCCCTATTTTACAGATGGGGG - Intronic
1200885018 Y:8259006-8259028 TGTCTCTATTTTTCAGCCTGGGG + Intergenic