ID: 1072617542

View in Genome Browser
Species Human (GRCh38)
Location 10:97059701-97059723
Sequence TCCCTGTGCAGTCTGAGGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 293
Summary {0: 1, 1: 0, 2: 2, 3: 30, 4: 260}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1072617535_1072617542 7 Left 1072617535 10:97059671-97059693 CCTCCATTTGAAAAGCCCATGGC 0: 1
1: 0
2: 0
3: 8
4: 125
Right 1072617542 10:97059701-97059723 TCCCTGTGCAGTCTGAGGGCTGG 0: 1
1: 0
2: 2
3: 30
4: 260
1072617533_1072617542 17 Left 1072617533 10:97059661-97059683 CCAGATCTCTCCTCCATTTGAAA 0: 1
1: 0
2: 1
3: 25
4: 311
Right 1072617542 10:97059701-97059723 TCCCTGTGCAGTCTGAGGGCTGG 0: 1
1: 0
2: 2
3: 30
4: 260
1072617536_1072617542 4 Left 1072617536 10:97059674-97059696 CCATTTGAAAAGCCCATGGCCGC 0: 1
1: 0
2: 0
3: 6
4: 76
Right 1072617542 10:97059701-97059723 TCCCTGTGCAGTCTGAGGGCTGG 0: 1
1: 0
2: 2
3: 30
4: 260
1072617537_1072617542 -8 Left 1072617537 10:97059686-97059708 CCCATGGCCGCTATTTCCCTGTG 0: 1
1: 0
2: 0
3: 10
4: 109
Right 1072617542 10:97059701-97059723 TCCCTGTGCAGTCTGAGGGCTGG 0: 1
1: 0
2: 2
3: 30
4: 260
1072617538_1072617542 -9 Left 1072617538 10:97059687-97059709 CCATGGCCGCTATTTCCCTGTGC 0: 1
1: 0
2: 0
3: 3
4: 98
Right 1072617542 10:97059701-97059723 TCCCTGTGCAGTCTGAGGGCTGG 0: 1
1: 0
2: 2
3: 30
4: 260

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1072617542 Original CRISPR TCCCTGTGCAGTCTGAGGGC TGG Intronic
900494070 1:2968478-2968500 CCCCTCTGCAGCCTGGGGGCCGG + Intergenic
900585249 1:3429513-3429535 TCCCTGTCCACTCTGAGGACGGG - Intronic
901020411 1:6252472-6252494 TCCCTGTGCAGATGGAGGGCAGG - Intronic
901491288 1:9597632-9597654 TCCCTGGGCTGGCCGAGGGCAGG - Intronic
902213439 1:14920304-14920326 GCCCTGTCCAGCCTGAGGTCAGG + Intronic
902238359 1:15072361-15072383 TGCATTTGCACTCTGAGGGCTGG - Intronic
903182149 1:21610144-21610166 TCGTGGTGCAGGCTGAGGGCGGG - Exonic
903229541 1:21913498-21913520 TCCGTGGGCTGTCTGAGGGCAGG - Intronic
903322606 1:22551980-22552002 CCCAGGTGCAGACTGAGGGCAGG + Intergenic
903466352 1:23554861-23554883 TCCCTCCGCAGCCTGCGGGCGGG - Intergenic
903621782 1:24703405-24703427 TCCCTGTGCAACCCAAGGGCAGG + Intergenic
903750291 1:25617080-25617102 TCCCTGCGCTGTCTGGGGCCCGG + Intergenic
903859032 1:26354195-26354217 GCCCTGAGGAATCTGAGGGCTGG - Intergenic
903928443 1:26848597-26848619 TGCCTGTGTTGTCTGAGGGAAGG - Exonic
904555085 1:31356598-31356620 TTACTCTGCAATCTGAGGGCAGG - Intronic
904605855 1:31697188-31697210 TCCCTGGGCAGCCCAAGGGCCGG + Intronic
905175213 1:36131022-36131044 TCCCTGGGCTGTCTAAGGGAAGG - Intergenic
905474893 1:38219168-38219190 CCACTGTGCTGTCTGAGGACAGG + Intergenic
907006493 1:50919973-50919995 TCCCTGAGTGGTCTGAGGTCAGG + Intronic
907263585 1:53239996-53240018 TCCGTGTTAAGACTGAGGGCCGG - Intergenic
912450466 1:109764853-109764875 GTCCTGTGGAGTCTGAGGGCTGG + Intronic
914704492 1:150159813-150159835 TCCCTGTGCCGTCTTGGGGGCGG - Exonic
915118655 1:153615370-153615392 TTCCTGAGCATCCTGAGGGCAGG + Exonic
915300479 1:154948539-154948561 TCCCTGCCCAGTCTGGAGGCAGG + Intronic
915525786 1:156475521-156475543 TCCCAGTGCAGAGTGAGGGAAGG + Intronic
915834620 1:159166057-159166079 TCCATGTGCTCTTTGAGGGCAGG - Intergenic
916579862 1:166097385-166097407 TGCCTGTGCAGTCTGTATGCTGG - Intronic
916845397 1:168645069-168645091 TACCTCTGACGTCTGAGGGCAGG + Intergenic
917168150 1:172137037-172137059 TCCCTTTGGAGTCTGAAGGACGG + Intronic
918079058 1:181191855-181191877 ACCATGTGCCGTCTGAGGGCTGG + Intergenic
918080445 1:181203881-181203903 TCTCTCTGCAGTCTGGGAGCAGG + Intergenic
918497552 1:185157085-185157107 ACACTGCGCAGTCTGGGGGCGGG + Intronic
920319349 1:205106256-205106278 TCCCTGTGCAGTATCAGAGGAGG + Intronic
921179471 1:212620260-212620282 TCCATGGGCAGTATGATGGCAGG + Exonic
921934749 1:220786456-220786478 CCCCTGGGCAGACTGAGGGGAGG + Intergenic
1062906455 10:1182923-1182945 TTCCTGTGGAGTCTGAGGGAGGG - Exonic
1063114892 10:3066794-3066816 TTCCTCTGCAGCCTGAGGTCGGG - Intronic
1063383951 10:5604291-5604313 TCCTTCTGAAGTCTGAGGACAGG - Intergenic
1063945306 10:11170309-11170331 TTACTGAGAAGTCTGAGGGCAGG - Intronic
1065316309 10:24467261-24467283 TCCGTGTGCAGTCTGTGGGCAGG + Intronic
1069714825 10:70513985-70514007 TCCCCCTGCTCTCTGAGGGCGGG + Intronic
1071430924 10:85606067-85606089 TCCACATTCAGTCTGAGGGCTGG - Intronic
1072617542 10:97059701-97059723 TCCCTGTGCAGTCTGAGGGCTGG + Intronic
1073328086 10:102654115-102654137 ACCCTGAGCTTTCTGAGGGCAGG - Intronic
1073585800 10:104708778-104708800 ACCCAGTGCAGTCTGAGGCCTGG - Intronic
1076714414 10:132356052-132356074 TGCCTGTGCAGGCTGCTGGCTGG + Intronic
1076820702 10:132938032-132938054 TCTCTGTGCAGGCTGGGGACGGG - Intronic
1076866247 10:133167790-133167812 TCCCTCTGGTGTCTGAGGGTAGG - Intronic
1077245012 11:1532545-1532567 TGGCTGTGCAGGCTGTGGGCTGG - Intergenic
1077912588 11:6586555-6586577 TCCCTGTGCAGCCAGAGGGATGG - Intronic
1078347295 11:10562093-10562115 TCTCTGTTTAGTCAGAGGGCTGG + Intronic
1078355299 11:10628114-10628136 TCCCTTTGCAATCTCAGGCCTGG + Intronic
1078874061 11:15376289-15376311 TCCCTCTGGAGTCTGAGGGGTGG + Intergenic
1080640482 11:34155619-34155641 TGCCTCTGCAGCCTCAGGGCCGG - Intronic
1080668591 11:34357015-34357037 TCCCTGTACAGCATGAGCGCCGG - Exonic
1081080499 11:38733861-38733883 TCCCTGTGCAGCCTAGGGACTGG - Intergenic
1081551912 11:44121575-44121597 CCTCTGTGCAGTGTGGGGGCAGG - Intronic
1083121331 11:60515397-60515419 TCCCTGAGGAGCCTGAGAGCCGG + Exonic
1083428185 11:62600248-62600270 TCCATTTGCAGTCTAAGGGGAGG + Exonic
1083988438 11:66232113-66232135 TCCCTGGGGAGCCTGAGGACAGG - Intronic
1085641452 11:78195608-78195630 ACCCTGTCCACTCTCAGGGCAGG - Intronic
1085654343 11:78299012-78299034 TCCCTGTTGAGACTGAGGCCTGG - Intronic
1087913839 11:103784796-103784818 TACCTGTGCAGCCTGAAGACGGG - Intergenic
1091064763 11:132499208-132499230 TTCCTATGCTGTCTTAGGGCTGG - Intronic
1091104373 11:132904777-132904799 ACCCTGGGCAGTCTGAGTGGTGG + Intronic
1091322200 11:134659639-134659661 TCCCAGTGCAGTCTGAAACCAGG - Intergenic
1091950191 12:4586271-4586293 TTCCTGTGCAGTCTAAGACCTGG - Intronic
1094484307 12:30912145-30912167 ACCCTGAGAAGTCTGAGAGCTGG - Intergenic
1095701280 12:45193587-45193609 TTCCTGTGAATTCTGAGGTCTGG + Intergenic
1099508867 12:83509296-83509318 TCCCTCTGCAAGCTGAGGTCTGG + Intergenic
1101781928 12:107844910-107844932 TGCCTGACCAGTCTGCGGGCCGG + Intergenic
1102522039 12:113484110-113484132 TCAATATCCAGTCTGAGGGCTGG + Intergenic
1105728622 13:23189087-23189109 TCCCTGTGTAGTGAGAGGACGGG - Intronic
1106220865 13:27745316-27745338 TCCCTGTGCATTTTGAGGCTGGG - Intergenic
1106416613 13:29551161-29551183 AGACTGTGCACTCTGAGGGCAGG - Intronic
1106863574 13:33937915-33937937 TCTCTGTACAGTCAGAGGGGTGG + Intronic
1110191916 13:72739998-72740020 TCCATGTGCGGTATGAGGGTTGG + Intronic
1113450760 13:110407774-110407796 TCCCAGTGCAGTGTGAGGACGGG + Intronic
1113957562 13:114107476-114107498 TGCCTGTCCTGTCTGAGGGCTGG + Intronic
1116423408 14:44760635-44760657 TCCCTCTGAATCCTGAGGGCAGG - Intergenic
1117007910 14:51441153-51441175 TCCTTCTGCAGCCAGAGGGCGGG + Intergenic
1118689602 14:68325442-68325464 TCCCTGTGCAATAAAAGGGCGGG - Intronic
1118842578 14:69524209-69524231 TCCCTGTGGAGACAGAGGGCTGG - Exonic
1121080398 14:91103291-91103313 CCCATTTGCAGTCTGAGGCCAGG - Intronic
1122816952 14:104318698-104318720 TCCCTGTTAAGTCGGAGGGGTGG + Intergenic
1123040649 14:105488936-105488958 TCCCTGTGCAGGGTGAGTCCAGG + Intronic
1123176408 14:106422991-106423013 TCCTTGTGCTGTCAGAGGGAAGG - Intergenic
1124226890 15:27902733-27902755 TTCCTCTGCAGGCTGGGGGCGGG + Intronic
1124468322 15:29960710-29960732 TTCCTGTGGAGTCTGTGGGCAGG - Intronic
1124963961 15:34419500-34419522 TTGCTGTGCACTTTGAGGGCAGG + Intronic
1124980575 15:34565731-34565753 TTGCTGTGCACTTTGAGGGCAGG + Intronic
1127961613 15:63894729-63894751 TTCCTGGGCAGTGTTAGGGCAGG + Intergenic
1128192768 15:65719277-65719299 ACCCTGTGCAAACTGAGTGCAGG + Intronic
1129615652 15:77097353-77097375 TGCCTGTGCAGCCTGAGTCCAGG + Intergenic
1129876875 15:78981356-78981378 TCCCTGTGTAGCCCGAGGGAAGG + Intronic
1130567170 15:85006363-85006385 TCTCAGTGCAAGCTGAGGGCAGG + Intronic
1133168297 16:3964518-3964540 GCCCTGTGCCATCTGAGAGCGGG + Exonic
1134243526 16:12523203-12523225 TCCCTGTGCAGGCACAGAGCTGG - Intronic
1134254484 16:12600382-12600404 TCCCTGTGCTCTCAGGGGGCTGG + Intergenic
1136657483 16:31718857-31718879 GTCCTGTGCAGACTGAGGTCAGG + Intronic
1138540405 16:57684245-57684267 TCCCTCTGCACCCTCAGGGCCGG - Intronic
1139650344 16:68359169-68359191 TCCCTGTGCAGGCAGTCGGCAGG + Exonic
1142141846 16:88476080-88476102 CCCCTGTGGGGTCTGAGGCCTGG - Intronic
1142262874 16:89050837-89050859 CGCCTGTGCCATCTGAGGGCAGG + Intergenic
1142374563 16:89700491-89700513 TCCCTGTGAAGTCTCAGGGCTGG - Intronic
1142563094 17:822756-822778 TCCCTATGCAGTGTGTGAGCAGG + Intronic
1143706227 17:8699290-8699312 TCCCTGTGCATTCAGAGGGGAGG + Intergenic
1145961033 17:28886662-28886684 TCCCTAGGCAGTCTGTGTGCAGG + Intronic
1146741528 17:35288259-35288281 GCCATGTGAAGCCTGAGGGCAGG - Intergenic
1147556017 17:41479561-41479583 CACCTGGACAGTCTGAGGGCAGG - Intronic
1147658612 17:42105163-42105185 TCCCTCTGCAGGCGGAGGGCAGG + Exonic
1148683463 17:49487514-49487536 TCCCTGGGGAGTCTGAGTCCCGG - Intergenic
1149443931 17:56699211-56699233 TTCCTTTGCAGCCTAAGGGCTGG - Intergenic
1151030638 17:70733943-70733965 TCCCTGTGCTCACTGAGGCCTGG - Intergenic
1152119290 17:78408400-78408422 TTCCTGTGCAGTCGGGGGGATGG + Intronic
1152604084 17:81280295-81280317 ACTCTGTGCAGTCAGATGGCTGG + Intronic
1154399526 18:14023362-14023384 TCCCTGAGCAGTCTAGAGGCAGG + Intergenic
1155499536 18:26472970-26472992 CCCAGGTGCAGACTGAGGGCTGG + Intronic
1157801286 18:50623467-50623489 TCACTGTGAAGACTGAGGACAGG - Intronic
1158670221 18:59467833-59467855 TCCCTGTGTACGCTGAGGGGAGG + Intronic
1160345453 18:78128379-78128401 TTCCTGTGCCTGCTGAGGGCTGG - Intergenic
1161572470 19:5038143-5038165 TCCCTGTGCAGTGGGTGGCCCGG + Intronic
1163737007 19:18987827-18987849 TCCCTGGCCAGCCTGAGGGTTGG - Intergenic
1163897678 19:20073943-20073965 TCCCTGTCCAGTGTGGGGACAGG + Intergenic
1163935275 19:20436661-20436683 TCCCTGCCCAGTGTGGGGGCAGG - Intergenic
1165714896 19:38037982-38038004 GCCCTGGGCAGTGTCAGGGCAGG + Intronic
1167327246 19:48834345-48834367 TCCCTGCAGAGTCTGGGGGCCGG - Exonic
1167440657 19:49506881-49506903 TCCTCGTGCAGTCTGAGGAGTGG + Intronic
1167757176 19:51420102-51420124 GACCTGTGCATACTGAGGGCCGG - Intergenic
1168630122 19:57949899-57949921 ACCCAGTGCTGGCTGAGGGCAGG + Intergenic
925027437 2:621022-621044 TCCCTGGGCAGCCTGCGGGGAGG - Intergenic
925522951 2:4768021-4768043 TCCTTGTGCACTCTGAGCCCAGG + Intergenic
925844863 2:8026163-8026185 TCCATGTGCTGTGTAAGGGCAGG - Intergenic
925978207 2:9155773-9155795 TGCCTGTGAGGTCTGAGGGAAGG - Intergenic
926083517 2:10007007-10007029 TGCCGGAGCAGCCTGAGGGCGGG - Intergenic
927864509 2:26580096-26580118 TCCATGTGGAGACTGAGGGGCGG + Intergenic
927943199 2:27118661-27118683 CCCCTGTGTACCCTGAGGGCAGG - Intronic
928647606 2:33371192-33371214 TCCTAGTGCAGTCTGCGGTCTGG - Intronic
928732947 2:34253789-34253811 TCCCAGTGCAGTAGGAGAGCTGG - Intergenic
929460132 2:42097304-42097326 TCGCTGCGCACTATGAGGGCTGG + Intergenic
932456247 2:71851779-71851801 TCCCTCTGAACACTGAGGGCTGG - Intergenic
934112191 2:88754326-88754348 CACCAGTGAAGTCTGAGGGCTGG - Intergenic
934660521 2:96141102-96141124 TCCCACTGCTGTCTGAGGGGTGG - Intergenic
935280208 2:101510904-101510926 GCCCTGTGCTGTGTGAGGGGTGG + Intergenic
937236956 2:120436938-120436960 TCCCTGAGCAGTCGGGAGGCAGG - Intergenic
937292033 2:120787554-120787576 GCCCCGGGCAGGCTGAGGGCTGG - Intronic
937989605 2:127654885-127654907 CCCCTTTGCAGTTTGAAGGCCGG - Exonic
938020391 2:127901499-127901521 TCCCTGTGTCGTCACAGGGCAGG - Intergenic
939980046 2:148769198-148769220 TCCCTGTGCTTTCAGAAGGCGGG + Exonic
942462616 2:176178657-176178679 GCCCTGGGAAGTCCGAGGGCAGG - Intergenic
942574388 2:177348127-177348149 ACTCTGTGCTGTCTGAGGGCAGG - Intronic
944984677 2:205161899-205161921 TTCCTGTGCATTCTGTGTGCTGG + Intronic
946002007 2:216490209-216490231 TTCCTGTGCAGTCTCAGTGAAGG + Intergenic
947810085 2:232998625-232998647 GCCCTGGGCAGTTTGGGGGCAGG + Intronic
948443393 2:238012892-238012914 ACACTGTGGAGTCTGATGGCAGG - Intronic
948609252 2:239156282-239156304 GCCATGTGCCGTCTGAGAGCAGG - Intronic
948677095 2:239603049-239603071 TGGCTGTGGAGTCTGAGGACAGG + Intergenic
948835614 2:240624699-240624721 GCCCTGTCCACCCTGAGGGCAGG - Intronic
1173302657 20:41817688-41817710 TCTTTGTGCATTCTGTGGGCAGG + Intergenic
1174138803 20:48398636-48398658 TCCCTGTGCTCTTTGGGGGCTGG - Intergenic
1174289860 20:49500401-49500423 TCACCGTGCATGCTGAGGGCTGG - Intergenic
1175656212 20:60773150-60773172 TCCCAGTGCACTCTGAGCACGGG + Intergenic
1175679674 20:60976825-60976847 TCCACGTGCAGTGTCAGGGCAGG - Intergenic
1175985243 20:62761181-62761203 TGGCTGTGCAGGCTGAGGTCTGG + Exonic
1176041703 20:63069078-63069100 TCCTTGTGCTGTCTGTGGGATGG - Intergenic
1176181859 20:63753202-63753224 GCCCAGTGGGGTCTGAGGGCTGG - Intronic
1177586487 21:23102445-23102467 ACCCTGAGAAGTCTGAGGGAGGG + Intergenic
1177806052 21:25875769-25875791 TTCCTGTTCATTCTGTGGGCAGG - Intergenic
1178595499 21:33949239-33949261 TCCCTGTGGAGAATCAGGGCGGG + Intergenic
1178643326 21:34364132-34364154 TACCTATGCAGTGTGTGGGCAGG - Exonic
1178848980 21:36197556-36197578 TCCCTCTACAGTGCGAGGGCAGG - Intronic
1179841690 21:44080108-44080130 TACCTGGGCTGTCTGACGGCTGG - Exonic
1180200106 21:46219141-46219163 CCCCTGTGCAGGCTGGGGGAGGG + Intronic
1180999869 22:19983077-19983099 CACCTGTGCAGTCAGAGGCCCGG - Intronic
1182048632 22:27296609-27296631 TCCTTGTGCAGGCTGAAGGCGGG - Intergenic
1182257800 22:29050704-29050726 TCCCTTGGCAGTCCGAGGGCAGG - Exonic
1182323133 22:29491312-29491334 TCCCTGGGAAGGCTGGGGGCAGG + Exonic
1182473366 22:30561972-30561994 CCCCTGGGCAGACTGAGGTCGGG + Intronic
1183237317 22:36629320-36629342 TCCCTGGGCAGGCTGTGAGCTGG + Intronic
1184406848 22:44305303-44305325 TGCCTGTGCTCCCTGAGGGCAGG - Intronic
1184516296 22:44964892-44964914 GCCCTCTGCAGTGTGAGGCCGGG + Intronic
1185223640 22:49641217-49641239 TCCCTGGGGTGTCTGTGGGCAGG - Intronic
950160419 3:10756631-10756653 GCCCTGTGCAGTGCCAGGGCTGG - Intergenic
950406471 3:12808199-12808221 GCCCTGTGCAGGCTCCGGGCTGG + Exonic
950436377 3:12982950-12982972 TCCCTCTGCAGCCTCAGGACAGG - Intronic
951420572 3:22479482-22479504 TCCCAGTGCTGTTTGAGGGGAGG - Intergenic
953107454 3:39898112-39898134 TGCCTTTGCAGTCTGTGGGTAGG + Intronic
954420888 3:50418525-50418547 TCCCTGAGCACTCCCAGGGCCGG + Intronic
954686047 3:52370838-52370860 TCCCTGTGCAGTCTCTGGGGAGG - Intronic
956340171 3:68213547-68213569 TCCCTGTGGAGTCAGGGGGTAGG + Intronic
956398819 3:68854322-68854344 GCCCTGTGCAGCCTGAGTCCTGG - Intronic
958751691 3:98199691-98199713 TGCCTGTTCACTCTGATGGCAGG - Intergenic
959969601 3:112394545-112394567 ACCATGTGCAGTGTGAGTGCAGG - Intergenic
960946133 3:122967961-122967983 TCCTTGGGCGGGCTGAGGGCTGG - Intronic
961393539 3:126570616-126570638 GCCCTGTGCTGTGTGAGGGGAGG - Intergenic
961479595 3:127171395-127171417 TCCCTGGGCAGTCTGAACGCTGG - Intergenic
961536355 3:127573287-127573309 TCACTGAGCAGTATGAGAGCAGG + Exonic
962276501 3:134018543-134018565 TCCCGGTGGAGACTGAGGGCTGG - Intronic
964668910 3:159203901-159203923 TCCCTGTGTGGTAAGAGGGCAGG + Intronic
966399843 3:179537059-179537081 TCACTGTGCAGTCTGAGAAAGGG - Intergenic
969523596 4:7692905-7692927 TCCCTCTGCAGTCTGACCTCTGG - Intronic
969664419 4:8548934-8548956 TCCCTGTGCAGTGGGGGGGCTGG - Intergenic
971021943 4:22546046-22546068 TCCATGTGCATTCTGCGGTCTGG + Intergenic
971232323 4:24809661-24809683 TCACTGTTTAGCCTGAGGGCTGG - Intronic
974607706 4:64174097-64174119 TCCCGGTGGAGTCTGTGGCCTGG + Intergenic
977748533 4:100580399-100580421 TCCCTGTGGGTTCTGAAGGCAGG + Intronic
980517994 4:133889750-133889772 TCCCTGTGTAGGCTGAGAGTGGG + Intergenic
980537516 4:134148081-134148103 TCTCTGTGCATTGTGAGTGCTGG - Intergenic
980992114 4:139747117-139747139 TCCCTGCACATTCTGAGGACAGG - Intronic
981240956 4:142474999-142475021 TCCGTCTGCACTCTGTGGGCAGG + Intronic
982376072 4:154692324-154692346 TCCCTGTGAAATCTGAAGGGAGG - Intronic
983939572 4:173525628-173525650 TGCCTGTGCAGGCTGCGGGAAGG - Intronic
984586950 4:181575800-181575822 TCTCTCTGCAGTCTGACAGCAGG - Intergenic
984953177 4:185021067-185021089 CCGCTGTGGAGTCTGAGGGAGGG + Intergenic
985619630 5:947411-947433 TCCCTAGGCTGTCTGAGGTCCGG + Intergenic
985759473 5:1737704-1737726 TCTCTGGGCTGTCTGAGGACAGG - Intergenic
992528068 5:77630511-77630533 TCCCAGTGCAGCCTGGCGGCCGG - Exonic
997295097 5:132764130-132764152 GCCCCCTGCAGTGTGAGGGCTGG + Intronic
999297482 5:150468662-150468684 TCCCTGTACAGCCTGAGGGGTGG - Intergenic
999306687 5:150524078-150524100 TCCCAGGGCAGTGTGAGAGCAGG + Intronic
1002448977 5:179308424-179308446 CCCCTGGGCAGGCTGAGGACAGG + Intronic
1004426685 6:15511562-15511584 GCCCTGTGCAATCTGATGGAAGG - Intronic
1005922515 6:30415111-30415133 TCCCTGTGTGGGCTGAGTGCCGG - Intergenic
1006045414 6:31291626-31291648 TCCCCTTGCAGACTGAGGGCTGG - Intronic
1006059681 6:31410944-31410966 TCCCTGTGTGGGCTGAGTGCCGG - Intronic
1006449789 6:34099306-34099328 TTCCCCTGCAGGCTGAGGGCAGG - Intronic
1007368798 6:41412970-41412992 CCCCTGTGTAAACTGAGGGCAGG + Intergenic
1007369105 6:41414525-41414547 CCCCTGTGTAAACTGAGGGCAGG - Intergenic
1007988955 6:46234935-46234957 TCCCTGTGCTGACTAGGGGCTGG + Intronic
1018716402 6:166536026-166536048 TCCTGGTGCAGTCTGAGGTCAGG + Intronic
1019014108 6:168867387-168867409 GTCCTGTGGTGTCTGAGGGCAGG - Intergenic
1019154681 6:170031113-170031135 TCCCCCTGCAGCCTGAGGGCAGG + Intergenic
1019514345 7:1433154-1433176 TCCCTGTGCCCTCCGAGGACTGG - Intronic
1019655584 7:2193149-2193171 TCCCTGTTCTGACTGAGGGTTGG - Intronic
1021764024 7:23928898-23928920 TTCCACTGCAGTCTGGGGGCGGG - Intergenic
1022274884 7:28845681-28845703 TCCCTGTGCACTCTTACTGCTGG - Intergenic
1022791325 7:33692208-33692230 TCCCTGTGCTGTCAAGGGGCCGG + Intergenic
1024127746 7:46317996-46318018 TTCCAGTGTAGTCTGAGTGCTGG - Intergenic
1026382632 7:69814649-69814671 TCACTGTGCAGGCTGAAAGCAGG - Intronic
1027829210 7:83155783-83155805 TGCCTGTTTAGTCTGAGGCCTGG + Exonic
1033537314 7:142323957-142323979 TCCCTGGGCAGTCCCAGGCCAGG - Intergenic
1033706048 7:143885514-143885536 TCCTGCTGCACTCTGAGGGCGGG - Intronic
1034122848 7:148643199-148643221 TCCCCTCACAGTCTGAGGGCAGG + Intergenic
1035362619 7:158323274-158323296 TCACTGTGCAGACAGAAGGCTGG + Intronic
1035362639 7:158323373-158323395 TCACTGTGCAGACAGAAGGCTGG + Intronic
1037129369 8:15389121-15389143 TCAGTCTGCAGCCTGAGGGCTGG + Intergenic
1037671339 8:21017684-21017706 TACGTTTGCAGTCAGAGGGCTGG + Intergenic
1039468740 8:37800995-37801017 TCCTTGGGGAGTCTGAGTGCTGG + Intronic
1040664023 8:49609680-49609702 ACCCTGACCAGTCTGAAGGCCGG + Intergenic
1041680409 8:60583135-60583157 TCCATGCGCATTCTGAGGGTGGG + Intronic
1041708193 8:60868758-60868780 TCCCTGAGGAGGCTGAGGCCCGG + Intergenic
1042435921 8:68764435-68764457 TACCAGTGCAGTCAGTGGGCAGG + Intronic
1043097996 8:75999974-75999996 TCCCGGTACAGTCTGTGGCCTGG + Intergenic
1046496372 8:115019466-115019488 TCCCTGTGCAATCTTGAGGCAGG + Intergenic
1046783528 8:118241259-118241281 TATCTGTGTAATCTGAGGGCAGG + Intronic
1048403180 8:134091081-134091103 TGCCTGTGCAGTGAGAGGGGTGG + Intergenic
1049019016 8:139941192-139941214 CTCCTGTGAAGGCTGAGGGCCGG - Intronic
1049107918 8:140625139-140625161 CCCAGGTGCAGGCTGAGGGCAGG - Intronic
1049785932 8:144450837-144450859 TCCCTGACCAGGCCGAGGGCAGG + Intronic
1050290711 9:4151438-4151460 TCCCTGAGCAGTCTGAATGTTGG - Intronic
1052707406 9:32010460-32010482 GCCCTGTGCAGTGAGAGGTCCGG - Intergenic
1053136139 9:35651127-35651149 TCCCTGAGGACTCTGAGGGCGGG + Intergenic
1054761473 9:69008142-69008164 TCCCTGTGCACTTGGAGGGCAGG + Intronic
1057132305 9:92662576-92662598 TACTTCTGCAGTCTGAGGGCTGG + Intronic
1057429410 9:94980223-94980245 GCCCTGGGAAGTCTGAGGGTGGG + Intronic
1057746978 9:97760169-97760191 TCCCAGTGCAGTCTGACAGAGGG - Intergenic
1057758504 9:97854697-97854719 CCCCGGTGCAGCCTGCGGGCTGG - Exonic
1059176566 9:112174546-112174568 TCCCTGTGCGCGATGAGGGCGGG - Intronic
1059353787 9:113684528-113684550 TGCATGTGGTGTCTGAGGGCAGG - Intergenic
1059368538 9:113806486-113806508 GCCATGTGCAGCCTGTGGGCCGG + Intergenic
1059678930 9:116567441-116567463 TCTCTGTCCAGTCAGTGGGCTGG + Intronic
1059809129 9:117836431-117836453 TTCCTGTGCAGCCTGAGGTGAGG - Intergenic
1060722693 9:125989320-125989342 GCCCTGTGCTGTCTGGGGCCTGG + Intergenic
1061425012 9:130493260-130493282 TCCCTGTGTACAGTGAGGGCTGG + Intronic
1062584893 9:137244799-137244821 TCCCTGACACGTCTGAGGGCAGG - Intronic
1062630138 9:137459657-137459679 TCCCTGTGCAGTTTGGGAACTGG + Intergenic
1062689336 9:137833401-137833423 TGCCTGTGCAGCCCGAGGCCCGG - Intronic
1062723660 9:138058891-138058913 TCCCTTTGTTGTCTGTGGGCTGG + Intronic
1185523053 X:756172-756194 GTCCTGTGCAGGCTGTGGGCTGG - Intergenic
1185523119 X:756619-756641 ATCCTGTGCAGACTGTGGGCTGG - Intergenic
1185763915 X:2708976-2708998 TCACTGTGGCCTCTGAGGGCAGG + Intronic
1186025426 X:5305746-5305768 TGCCTGTGCAGCTGGAGGGCAGG - Intergenic
1186833602 X:13415928-13415950 CCCCTGGGAAGTCTGAGGGTAGG - Intergenic
1189848680 X:45158255-45158277 GCACTGGGCAGGCTGAGGGCAGG + Intronic
1190277368 X:48907585-48907607 CCCATGTGCCGTCTGAGGGCAGG + Intronic
1191790883 X:64970609-64970631 TCCCTGTGGAGTCTGTGGTTGGG + Intronic
1192538575 X:71949494-71949516 TCCCTGTGGAGTGTTAGGGTCGG + Intergenic
1197899914 X:131359464-131359486 CAACTGTGAAGTCTGAGGGCTGG + Intronic
1199360131 X:146907636-146907658 TCCCTGTGCTCTTTGGGGGCTGG - Intergenic
1199826294 X:151503895-151503917 AGGCTGTGCACTCTGAGGGCAGG - Intergenic
1200972096 Y:9163718-9163740 TCCCTGTGCTTTCTGGGGCCTGG + Intergenic
1201073559 Y:10170681-10170703 GCCCAGTGCAGGCTGAGTGCTGG - Intergenic
1202138928 Y:21700573-21700595 TCCCTGTGCTTTCTGGGGACTGG - Intergenic