ID: 1072618417

View in Genome Browser
Species Human (GRCh38)
Location 10:97064488-97064510
Sequence CGGGTGATGGGACGCGTCCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1072618409_1072618417 10 Left 1072618409 10:97064455-97064477 CCAAGGCTGGTAGGATAGGGAGA 0: 1
1: 0
2: 0
3: 18
4: 189
Right 1072618417 10:97064488-97064510 CGGGTGATGGGACGCGTCCCAGG No data
1072618402_1072618417 28 Left 1072618402 10:97064437-97064459 CCGACAGCACCATAGACTCCAAG 0: 1
1: 0
2: 0
3: 10
4: 142
Right 1072618417 10:97064488-97064510 CGGGTGATGGGACGCGTCCCAGG No data
1072618405_1072618417 19 Left 1072618405 10:97064446-97064468 CCATAGACTCCAAGGCTGGTAGG 0: 1
1: 0
2: 0
3: 9
4: 119
Right 1072618417 10:97064488-97064510 CGGGTGATGGGACGCGTCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1072618417 Original CRISPR CGGGTGATGGGACGCGTCCC AGG Intronic
No off target data available for this crispr