ID: 1072618522

View in Genome Browser
Species Human (GRCh38)
Location 10:97065104-97065126
Sequence TGCTCCCCAGGGGATATGTA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 136
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 121}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1072618522_1072618532 27 Left 1072618522 10:97065104-97065126 CCTTACATATCCCCTGGGGAGCA 0: 1
1: 0
2: 0
3: 14
4: 121
Right 1072618532 10:97065154-97065176 ACACACACACACACACATTTTGG 0: 30
1: 297
2: 1336
3: 6262
4: 6710

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1072618522 Original CRISPR TGCTCCCCAGGGGATATGTA AGG (reversed) Intronic
900111241 1:1006461-1006483 TCCTCCCCATGGGATCTGGAGGG + Intergenic
901026781 1:6282494-6282516 TGCTCCCCAGGAAATATATCTGG + Intronic
904718887 1:32491309-32491331 TGCTCCTCAGGGGCTATGGATGG - Exonic
907669893 1:56465085-56465107 TGCTCCCCTGGAGTTGTGTAAGG - Intergenic
912970020 1:114272374-114272396 TGTTCCCCAGGAGTTATGTGGGG + Intergenic
914139890 1:144936581-144936603 TCCTCCCCAGGTTAGATGTAAGG - Intronic
915339058 1:155166588-155166610 TGCTCCCCAGGGGCTGGGGAAGG - Intergenic
920485058 1:206362120-206362142 TCCTCCCCAGGTTAGATGTAAGG + Intronic
921319875 1:213928250-213928272 GGCTCCCCAGTTGATATATATGG - Intergenic
922894539 1:229089989-229090011 TACCCCCCAGGGGAAATGCAAGG - Intergenic
924494702 1:244575745-244575767 TGCTCCCTAGGGGAAAGGGAAGG - Intronic
1063004976 10:1961610-1961632 TGCTCCCCAGAGGAAATGCTTGG - Intergenic
1067409003 10:46048422-46048444 TGCTCCCCAGGGGTTGAGAAAGG + Intergenic
1068522425 10:58092873-58092895 TGGTCTCCAGGGGTTATGAATGG + Intergenic
1070652773 10:78249914-78249936 TGCCCCCCAGGGGACATTTTTGG + Intergenic
1070662429 10:78316835-78316857 TTTTCTCCAGGGGATATATAAGG + Intergenic
1071716661 10:88103873-88103895 TGCTCCCCAGGGTTCATGTGAGG + Intergenic
1072618522 10:97065104-97065126 TGCTCCCCAGGGGATATGTAAGG - Intronic
1075719846 10:124578213-124578235 TGCTTCCCAGGGCATTTGCAAGG + Intronic
1077671937 11:4165542-4165564 TGCTCCCCTGGGGAAAAGTAGGG - Intergenic
1080088817 11:28319087-28319109 ATCTCCCCAAGGGAAATGTAGGG + Intronic
1082932118 11:58618977-58618999 TGGGCCCCAAGGGAAATGTAAGG - Exonic
1084522763 11:69674752-69674774 GGCTCCCCAGGGGCTCTGGAGGG + Intronic
1087823153 11:102733876-102733898 TGATCCCCAGGAGACTTGTAGGG - Intergenic
1087829947 11:102808500-102808522 TGCTCAACAGGGGAAATGTTAGG + Intergenic
1087963570 11:104383456-104383478 TGATCCCTAGGAGATATGGAAGG + Intergenic
1090570192 11:128037251-128037273 TGCTGGCCAGGGCATATGCAGGG + Intergenic
1091611054 12:2009863-2009885 TGTTCCCCAGGGTATAGGTGAGG - Intronic
1097222939 12:57461258-57461280 GGTTTCCCGGGGGATATGTAAGG + Intronic
1098345974 12:69503796-69503818 TGCACCCCAGGGGTGATGTAGGG - Intronic
1103026655 12:117579687-117579709 TACTCCCCAGGTGATATGACCGG - Intronic
1105988752 13:25596442-25596464 TGCTTGCCTGGGGATATGGAGGG - Intronic
1106355127 13:28974983-28975005 TTCTTCCTAGGGGAAATGTAAGG + Intronic
1106417946 13:29561466-29561488 AGCTCCCGAGGGGATATGTCGGG + Intronic
1111050674 13:82879996-82880018 AGCTCCCTATGGGATATTTATGG - Intergenic
1111170073 13:84515494-84515516 TGCAACCCAGGGAATATCTAAGG + Intergenic
1116230497 14:42209551-42209573 AGCTCCCCAAGTGATTTGTATGG - Intergenic
1117148731 14:52863125-52863147 TGCTGCCCTGGGGAACTGTATGG - Intronic
1119127369 14:72140128-72140150 TGCTCCCCAGGAAATGTGCATGG + Intronic
1120763580 14:88307940-88307962 TGCTCCCTAGGGAGTAGGTATGG - Intronic
1121613282 14:95295469-95295491 TGCTGCACAGGGGATACGTACGG + Intronic
1122409466 14:101518535-101518557 TGAACCCCAGGGGATAGGGATGG - Intergenic
1123816950 15:23990073-23990095 TGCTCCCCAGGTAACATGGAAGG + Intergenic
1124634917 15:31359161-31359183 TGCTCCTCAATGGATAAGTAGGG - Intronic
1127857923 15:62967706-62967728 TGCTCTCCAGGGGATGTTTATGG - Intergenic
1128562852 15:68679907-68679929 TGCTCCATCAGGGATATGTAAGG - Intronic
1129065214 15:72897386-72897408 TGCTACACAGGGAATATTTAAGG - Intergenic
1130585620 15:85179183-85179205 TGCTTCCCAGGGAAGTTGTAAGG - Intergenic
1131258818 15:90878026-90878048 TGCACCCCAGGGGATGAGTAAGG - Intronic
1132227134 15:100151211-100151233 TGCTCCCCAGGGGAATGGCAGGG + Intronic
1135244976 16:20847787-20847809 TGCTCCTCAGGGGCAGTGTATGG + Intronic
1141701400 16:85643827-85643849 TGCTGCCCAGGGGAAAAGTTGGG - Intronic
1148509666 17:48157817-48157839 TGCTCCCCAGTGGCTAGGTGTGG - Intronic
1152012713 17:77728215-77728237 TGCTCCCCAGGCAATGTGTTTGG - Intergenic
1156624815 18:38895846-38895868 TGCTCCTCAGGGTATATGTGGGG + Intergenic
1157207873 18:45715743-45715765 AGGTCCCCAGGGGATTTGTTTGG - Intergenic
1159933031 18:74333739-74333761 TCCTCCCTAGGGCATATGGATGG - Intronic
1160039616 18:75333744-75333766 GGGTCCCCAGGGGATATTTAGGG + Intergenic
1161313059 19:3605183-3605205 GGCTCCCCAGGGAGCATGTACGG + Intronic
1161555814 19:4941972-4941994 TGCCCCTCTGGGGATTTGTAGGG - Intronic
1161561050 19:4972603-4972625 TGCTTCCCAGGGGACATTTTTGG - Intronic
1168147141 19:54426158-54426180 TGCTCCCCACGTTACATGTAGGG + Intronic
1168329354 19:55557735-55557757 TGCAGCCCAGGGGATATTTAGGG - Intergenic
925278531 2:2667351-2667373 GGTTCCCCAGGTGATATGGAGGG + Intergenic
925908141 2:8551818-8551840 TGCTCCCCAGGAGAGCTGGAAGG - Intergenic
933725930 2:85427296-85427318 TCATCCCCAGGGAATATCTATGG + Intronic
937999271 2:127719615-127719637 TGCTCCCCAAGGGATGATTATGG - Exonic
938195700 2:129325688-129325710 TGTTCCCCAGAGGATATTCAGGG - Intergenic
940749680 2:157611863-157611885 TGGTCCCCTGGTGATATGCAGGG + Intronic
942088109 2:172462255-172462277 GGCTGCCCAGGGGATTTGCAAGG + Intronic
943823377 2:192356614-192356636 TGCTCCCCAGTGGAGAAATAAGG - Intergenic
944484695 2:200192680-200192702 TGCCCCCCTCAGGATATGTATGG - Intergenic
944687623 2:202131796-202131818 TGCACCCCAGGGTACATGCAGGG + Intronic
946341893 2:219074975-219074997 TGCTCCCCAGGGGCTCTTCAAGG - Intergenic
948646170 2:239406541-239406563 TGCCCCACAGGGGTTAAGTAAGG + Intergenic
1171021048 20:21584422-21584444 GGCTCCCCAGGGAAGATGGAAGG - Intergenic
1172633372 20:36393548-36393570 TGCTCCCCAGGGGCTCGGTGTGG - Intronic
1173524502 20:43721549-43721571 TGCACCCCAGGGGCCATGAATGG - Intergenic
1176979072 21:15358499-15358521 CTCTCCCCAGTGAATATGTATGG - Intergenic
1183055884 22:35305290-35305312 TGCTTCCCAGAGGATTGGTAAGG + Intronic
1184154775 22:42660176-42660198 TGCTCCCCAGGGGTGTTGTGTGG - Intergenic
950056276 3:10027252-10027274 TGCTCCACAGGGTATACCTAGGG - Intronic
950435427 3:12976443-12976465 GGCTCCCAGGGGGATCTGTAAGG - Intronic
950775442 3:15346004-15346026 GGCTCACCTGGGGTTATGTATGG + Intergenic
954849516 3:53588510-53588532 TGCTTCCCAGAGGTTATGGAAGG + Intronic
955036501 3:55273204-55273226 TGCTCCCCATGGAATATTTGGGG - Intergenic
955962021 3:64350435-64350457 TGCACCCCAGGAGACATTTAGGG + Intronic
956739611 3:72265390-72265412 TCCTCCCCAGGGTAGATGTCAGG - Intergenic
960477769 3:118150886-118150908 AGCTTCCAAGGGGTTATGTATGG - Intergenic
960719996 3:120616382-120616404 TTCTACACAGGGGATATGTGGGG + Intergenic
965633307 3:170755613-170755635 TGCTCACCAAGGGCTCTGTATGG - Intronic
965945871 3:174240874-174240896 TGCAACCCAGGGGATATACATGG + Intronic
972259340 4:37392531-37392553 TGCTCCCCAGGAGACATTTTGGG - Intronic
973702773 4:53553284-53553306 AACTCCCCAGGGGATCCGTATGG - Intronic
977311610 4:95394918-95394940 TGCTCACCAGGGGATAGATCAGG + Intronic
978478284 4:109157783-109157805 TGCTCCCCTGGGCATAAGCAGGG - Intronic
978806163 4:112802830-112802852 TCCTCCCGAGGTGATATGTTAGG + Intergenic
979474031 4:121133925-121133947 TCCTCCCCAGAGGATTTGGAAGG + Intronic
980454471 4:133021193-133021215 TGCTCCCCAGGGGATGGGGATGG - Intergenic
986177793 5:5366640-5366662 TGCTCCCCAGGGCACGTGTGTGG - Intergenic
987149207 5:15021820-15021842 TGCCTCCCAGGGGACATGTTTGG + Intergenic
993045376 5:82860535-82860557 TCCTCCTAAGGGGATATGTAGGG - Intergenic
994575148 5:101568115-101568137 TGCTCCCCATGGAAAATTTATGG - Intergenic
996612335 5:125397261-125397283 TGCTCCCCTAGGGAGATGTATGG + Intergenic
998566044 5:143216735-143216757 TGCTCCTCAGGGAATTTGAAAGG - Intronic
999386671 5:151158370-151158392 TTGTCCCCAGGGGATTGGTAAGG + Intergenic
1000018204 5:157296896-157296918 TGCTCACCCAGGGATGTGTAGGG - Intronic
1000116179 5:158155634-158155656 TGATCCCCGGGGTAAATGTATGG + Intergenic
1000910204 5:167012799-167012821 TGCTCCCCATGGTATATGCTTGG - Intergenic
1001954702 5:175841171-175841193 AGCTCACCAGAGGGTATGTATGG - Intronic
1003625287 6:7735879-7735901 TTCTCCACAGAGGATTTGTAGGG - Intronic
1005771104 6:29072438-29072460 TGGTACCCAGGGGATATTTTAGG - Intronic
1006984495 6:38167891-38167913 TGCTTCCCAGGGGAGATGCGGGG - Intergenic
1013499235 6:110731228-110731250 AGATCCCCAGGTGATACGTAGGG + Intronic
1016171833 6:141027059-141027081 TGCTTACCTGGGGATGTGTATGG - Intergenic
1019395963 7:817692-817714 TTCTCCACAGTGGAGATGTAGGG - Intronic
1022459102 7:30587178-30587200 TGATTCCCAGGGCATAGGTAAGG - Intergenic
1027237723 7:76307802-76307824 TGCCCCCCAGGGAATATGGGGGG + Intergenic
1028599474 7:92586675-92586697 TGGTCTCAAGGGGATATGTATGG + Intronic
1028867309 7:95728648-95728670 TGGTTCCCAGGGGATAAGTGTGG + Intergenic
1029465070 7:100720437-100720459 TGCCCCCCAGGGGAGGTGTCCGG + Intergenic
1030865869 7:114701064-114701086 TGCTCGCCAGGGCCTATGGAAGG - Intergenic
1032549181 7:132768435-132768457 AACTCCCCAGGTGATATGTGAGG + Intergenic
1042745872 8:72104839-72104861 TGATTACCAGGGGCTATGTAGGG + Intronic
1044612525 8:94107677-94107699 TGCTGCCCAGAGGAAATTTATGG - Intergenic
1046724652 8:117661233-117661255 TGCTCTTCAGTGGTTATGTAAGG + Intergenic
1048950155 8:139489896-139489918 TGTTCCCCAGGGGCTTTGTCAGG - Intergenic
1057759779 9:97862876-97862898 TGCTTCCCAGGGGAGCTGTGAGG - Intergenic
1058861777 9:109123519-109123541 TGCTCTCAAGGGGCTCTGTAGGG - Intergenic
1059966021 9:119614705-119614727 TGCTCCCAAAGGGAGAAGTATGG + Intergenic
1060735693 9:126065392-126065414 TGCTCTGCAGGGGATGTGCATGG + Intergenic
1060777513 9:126386396-126386418 TGGTCCCCAGTGGTTATGCAGGG - Intronic
1197723299 X:129759400-129759422 TGCTTCCCCGGGGATATTTCAGG + Intronic
1200083050 X:153588873-153588895 TGCTCCCCAGGGGCTGGGTTAGG - Intronic
1200691143 Y:6306935-6306957 TGCTCCCCATGGGAATTGTGTGG - Intergenic
1201044129 Y:9867781-9867803 TGCTCCCCATGGGAATTGTGTGG + Intergenic