ID: 1072619308

View in Genome Browser
Species Human (GRCh38)
Location 10:97069025-97069047
Sequence CCATTAGGGCAGGCACCACC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 129
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 119}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1072619308_1072619314 -6 Left 1072619308 10:97069025-97069047 CCTGGTGGTGCCTGCCCTAATGG 0: 1
1: 0
2: 1
3: 8
4: 119
Right 1072619314 10:97069042-97069064 TAATGGCTTGATGGTTCTCCTGG No data
1072619308_1072619316 9 Left 1072619308 10:97069025-97069047 CCTGGTGGTGCCTGCCCTAATGG 0: 1
1: 0
2: 1
3: 8
4: 119
Right 1072619316 10:97069057-97069079 TCTCCTGGTCTGTGGACTTGTGG No data
1072619308_1072619315 1 Left 1072619308 10:97069025-97069047 CCTGGTGGTGCCTGCCCTAATGG 0: 1
1: 0
2: 1
3: 8
4: 119
Right 1072619315 10:97069049-97069071 TTGATGGTTCTCCTGGTCTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1072619308 Original CRISPR CCATTAGGGCAGGCACCACC AGG (reversed) Intronic
900144039 1:1150363-1150385 CCAGCAGGGCTGGCCCCACCCGG + Intergenic
901195914 1:7439655-7439677 CCCATAGGCCAGACACCACCTGG + Intronic
901316894 1:8315682-8315704 CCCCGTGGGCAGGCACCACCTGG + Intergenic
902793346 1:18784180-18784202 CCTTTAAGGCAGGCCCCAGCTGG + Intergenic
906001185 1:42427063-42427085 GAATTGGGGCAGGCACCACTGGG - Intergenic
909820312 1:80052536-80052558 GCATTGGGGCAGGCAACAACAGG - Intergenic
913254968 1:116944860-116944882 CCACGAGGGCAGGTTCCACCCGG + Exonic
920397820 1:205659565-205659587 CCATTAGGGAAGGGAGCTCCAGG + Exonic
1065201349 10:23316220-23316242 GCAGCAGGGCAGGCAGCACCAGG + Intronic
1065875345 10:29993154-29993176 CAATGATGGCAGACACCACCAGG - Intergenic
1067469812 10:46528198-46528220 CCACCAGGGCAGGAACCACAGGG + Intergenic
1069659663 10:70115255-70115277 CCTCTAGAGCAGGCACCTCCAGG - Intronic
1069924234 10:71837300-71837322 TCCTCAGGGCAGGCACCACTGGG + Intronic
1072619308 10:97069025-97069047 CCATTAGGGCAGGCACCACCAGG - Intronic
1072626989 10:97119048-97119070 CCATTCAGGCAGGCACTGCCTGG + Intronic
1074896233 10:117779978-117780000 CCATCCTGGCTGGCACCACCGGG + Intergenic
1076675824 10:132147311-132147333 TCATGAGGGCAGGGGCCACCAGG - Intronic
1077235358 11:1479518-1479540 CCATGAGGGCAGGGCCCAGCAGG + Intronic
1077530747 11:3093711-3093733 CCCTCAGGGCAGGCACGGCCGGG - Intronic
1083059580 11:59855920-59855942 CCATCAGGGCAGGTAAGACCTGG + Exonic
1083680527 11:64349665-64349687 CCAGGCGGGCAGGCATCACCTGG - Exonic
1084579661 11:70015360-70015382 CCCTGAGGGCAGGGAGCACCTGG - Intergenic
1085511540 11:77090761-77090783 CCAGGAGGGCAGGCAAGACCGGG - Intronic
1086351111 11:85943785-85943807 GCATTAGGGCAGGCAACCACAGG - Intergenic
1087011005 11:93513986-93514008 GCTTCAGGGCAGGGACCACCTGG + Intronic
1088960489 11:114658872-114658894 CCAGTAGGCTAGGCAGCACCAGG + Intergenic
1089149141 11:116351306-116351328 CCAATAAGGCAGACAGCACCAGG + Intergenic
1090995728 11:131864246-131864268 CCATCAGGGCAGGATCCATCAGG + Intronic
1094482824 12:30898347-30898369 CCATAAGGGCAGGGAACAGCTGG - Intergenic
1097053411 12:56236927-56236949 CCATCAGAGAAGGCAGCACCTGG - Exonic
1098987180 12:77025442-77025464 GCACTAGGTCAGGCTCCACCTGG - Intronic
1101502825 12:105320033-105320055 CCCATACGGCAGGCACCTCCTGG - Intronic
1101794439 12:107960002-107960024 AATTTAGGGCAGGCACCAACTGG - Intergenic
1106908762 13:34439820-34439842 GAATTAGTGCAGGCCCCACCAGG + Intergenic
1114634819 14:24181599-24181621 GCAGTAGGGCAGCCAGCACCTGG + Exonic
1116914789 14:50514212-50514234 GGACTAAGGCAGGCACCACCAGG + Intronic
1118200002 14:63663010-63663032 GCAGTAGGGCAGGCAGCTCCAGG + Intergenic
1119105153 14:71916680-71916702 CAATTAGGGCAAGCACCCCCGGG + Intergenic
1121693745 14:95895907-95895929 CCATCATGGCATCCACCACCAGG + Intergenic
1123711174 15:22988869-22988891 CGATTCAGGCATGCACCACCAGG + Intronic
1128294436 15:66505672-66505694 CCATAAGTAGAGGCACCACCCGG + Intronic
1130717583 15:86350857-86350879 CCATTAGGGCATAAGCCACCAGG - Intronic
1131130766 15:89898883-89898905 GCATTAGGGCAGGCCCAGCCAGG - Exonic
1132193262 15:99888258-99888280 GAATGAGGGCAGGGACCACCTGG + Intergenic
1132887849 16:2190272-2190294 CCTTCCAGGCAGGCACCACCCGG + Intronic
1136983877 16:35082473-35082495 CCAAAAGGGCAGGGACCTCCAGG - Intergenic
1138375818 16:56563326-56563348 CCTTTAAGGGAGGCACCACTTGG + Intergenic
1139294649 16:65889757-65889779 CTGTTAGGTCAGGAACCACCTGG + Intergenic
1139691234 16:68643352-68643374 CCCTTAAGGCCGGCCCCACCTGG - Intronic
1141512431 16:84521238-84521260 CCAACAGGGCTGGCATCACCTGG + Intronic
1143741049 17:8954334-8954356 CAAGTAGGCCAGGCACCCCCTGG + Intronic
1144205829 17:12978987-12979009 CCACAAGAGCAGGCACAACCTGG - Intronic
1147605805 17:41773170-41773192 CCATGAAGCCAGGCAGCACCCGG + Intronic
1148401298 17:47363959-47363981 CCTTTAGGGCATGCCCTACCAGG + Intronic
1150267039 17:63838428-63838450 CCAGTGGTCCAGGCACCACCTGG + Intronic
1152020656 17:77778738-77778760 CCCCAAGGGCAGGCCCCACCTGG - Intergenic
1152241774 17:79164742-79164764 GCATCAGGGCAGCCACCACGCGG - Intronic
1155386385 18:25282429-25282451 GCCTTAGGGGAGGCAGCACCCGG + Intronic
1157282810 18:46357329-46357351 CCACAAAGGCAGGGACCACCTGG - Intronic
1157485712 18:48085320-48085342 CCCTTTGGGTAGGCACCACAAGG - Intronic
1161024301 19:2028528-2028550 TGAACAGGGCAGGCACCACCGGG + Intronic
1167845643 19:52162103-52162125 CCACTAGGGCAGGGATCCCCAGG - Intronic
1168321526 19:55513107-55513129 CTCTTGGGGCTGGCACCACCAGG + Exonic
925390353 2:3490122-3490144 CCCCCAGGGCAGGCACCCCCAGG + Intergenic
926107237 2:10160086-10160108 CCATAAGAGCAGGAACCCCCTGG - Intronic
926331638 2:11830305-11830327 GCATCAGGACAGGCACCTCCAGG - Intergenic
934710370 2:96510155-96510177 CACACAGGGCAGGCACCACCAGG - Intergenic
936102010 2:109590393-109590415 TCATTAGGTCAGGCCCAACCAGG - Intronic
944391730 2:199225681-199225703 GCATTGGGGCAGGCAACAACAGG + Intergenic
944702391 2:202257722-202257744 GGATTACGGCATGCACCACCAGG + Intergenic
946220629 2:218222994-218223016 CCCTTAGGGCAGGCAGCAGGTGG - Intronic
947461469 2:230307616-230307638 GCATAAGGGCAGGCAACTCCAGG - Intronic
947464537 2:230330085-230330107 CCATCTGGGCAGGCTCGACCAGG + Intronic
947713380 2:232328330-232328352 CCAGGAGGGCAGGCACCACCTGG - Intronic
948461779 2:238133107-238133129 CCATTGGGGCAGGCAGGGCCGGG + Exonic
948569972 2:238911590-238911612 CCACTGGGGCTGGCATCACCGGG + Intergenic
1173790150 20:45823129-45823151 CCATCCCGGCTGGCACCACCCGG - Intergenic
1175786507 20:61715449-61715471 CCATGAGGGAAGGCATCACATGG + Intronic
1183350311 22:37331157-37331179 CCATTAGCGCCGGGCCCACCAGG + Intergenic
1184196145 22:42930009-42930031 CCTTGAGGGCAGGAACCACATGG + Intronic
1184441487 22:44519390-44519412 GCATTAGTGCAGACCCCACCAGG + Intergenic
949293828 3:2497030-2497052 CAATGTGGGCAGGCATCACCTGG - Intronic
950049618 3:9977245-9977267 CCATGAGAGCAAACACCACCAGG + Intronic
956128856 3:66036728-66036750 CCATAAGGACAGGCAGCAGCTGG - Intronic
956420831 3:69085188-69085210 TCATCATGGCAGCCACCACCAGG - Exonic
960095656 3:113687412-113687434 CAATGAGGACAGGCAGCACCTGG - Intronic
968230035 3:197000090-197000112 CCACCAGCACAGGCACCACCTGG + Intronic
974989804 4:69073038-69073060 ACATTAGGGAAGTGACCACCAGG - Intronic
978196266 4:105975941-105975963 CCAGTAGTGCAAGCACCACCTGG + Intronic
985916137 5:2920329-2920351 CCTTTAAGGCAGGAACCACCTGG + Intergenic
988344090 5:30014385-30014407 CAATGAGGGCAGGGAACACCTGG - Intergenic
993873343 5:93277459-93277481 CCAGAAGGAAAGGCACCACCGGG - Intergenic
997454167 5:134005113-134005135 CCATTAGCGCAGGGACCTCCGGG - Exonic
998793692 5:145793995-145794017 CCTATAGGTCAGGCACCACCAGG - Intronic
1001425139 5:171617903-171617925 TCAAAAGGGCAAGCACCACCTGG + Intergenic
1001648457 5:173298956-173298978 CCATCCGCGCTGGCACCACCTGG - Intergenic
1007166988 6:39835775-39835797 TCATTAGGGTAGGCACCAAGAGG - Intronic
1007690209 6:43695873-43695895 CCTGTAGAGCAGCCACCACCAGG - Intergenic
1008804980 6:55416093-55416115 CCATTTGGACAGGCAGCACTTGG + Intergenic
1010323443 6:74539438-74539460 CCATTAGGGCTGCCCCTACCTGG + Intergenic
1014168199 6:118249392-118249414 CTATTTGGGCAGACAGCACCAGG - Intronic
1015596525 6:134872337-134872359 GCATTGGGGCAGGCAACAACAGG + Intergenic
1019331552 7:463042-463064 CCATCAGGGGAGGCACCCCCTGG + Intergenic
1020495399 7:8845513-8845535 CCATTGGGGAAGGCATCACAAGG - Intergenic
1021771431 7:24005757-24005779 CCATGAGGGCAGAGACCTCCTGG + Intergenic
1026807355 7:73436552-73436574 CCACCAGGGCAGCCCCCACCAGG + Intergenic
1026909874 7:74085245-74085267 CTGTTAGGGCCGGCACCTCCAGG + Intronic
1032410074 7:131688370-131688392 GCATTAGGGCAGACAGCCCCGGG - Intergenic
1032613773 7:133443929-133443951 CCATTATGCCAGGCAGGACCAGG + Intronic
1032858508 7:135857325-135857347 ACATTGGGGCAGGCAGCTCCAGG + Intergenic
1034923884 7:155105170-155105192 CCCTCAGGGCAGGCACATCCAGG + Intergenic
1035334822 7:158121120-158121142 CCTTTGGAGCAGTCACCACCAGG - Intronic
1035470293 7:159104945-159104967 CCAGTAGGGCAGGCTCCATTTGG + Intronic
1036403480 8:8432037-8432059 CCCTTAGGGCAGGAAAAACCTGG - Intergenic
1047498044 8:125422467-125422489 CCATTAGGGCAGGGAATCCCAGG - Intergenic
1049197874 8:141325445-141325467 CCAGCATGGCAGGCACCACGTGG - Intergenic
1049334967 8:142079437-142079459 CCAGTACAGCAGGCACCCCCAGG + Intergenic
1050191663 9:3032954-3032976 CCAGTGAGGCAGGCAGCACCAGG + Intergenic
1053474801 9:38375038-38375060 CCATGATGGAAGGCACCACTTGG - Intergenic
1057149177 9:92781059-92781081 CCATGAGTGCAGACACCACATGG - Intergenic
1060497670 9:124130237-124130259 CCTTTAGGGCAGGCAGCTCCAGG - Intergenic
1061232349 9:129322092-129322114 CCATGAGGGCAGGAACCACATGG + Intergenic
1061671214 9:132189290-132189312 CCATGAGGCCAGGCAACACAGGG - Intronic
1061772473 9:132936678-132936700 CCATGAGGACAGGAACCATCTGG + Intronic
1061777133 9:132973098-132973120 CCTGGAGGGCAGGGACCACCGGG + Intronic
1062279568 9:135745926-135745948 CCACTCTGGCAGGAACCACCAGG + Intronic
1062619986 9:137416375-137416397 CCATCAGGCCGGGCACCCCCAGG + Intronic
1190908919 X:54754436-54754458 TGATTAGGTCAGGCCCCACCTGG - Intronic
1197179305 X:123517284-123517306 CCAACAGAGCAGCCACCACCTGG + Intergenic