ID: 1072619646

View in Genome Browser
Species Human (GRCh38)
Location 10:97071285-97071307
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1072619646_1072619654 13 Left 1072619646 10:97071285-97071307 CCAGATGGAGGCAGGAAGGAGTG No data
Right 1072619654 10:97071321-97071343 GTCCACAGAGTCAGGAAGGCGGG No data
1072619646_1072619652 9 Left 1072619646 10:97071285-97071307 CCAGATGGAGGCAGGAAGGAGTG No data
Right 1072619652 10:97071317-97071339 GGACGTCCACAGAGTCAGGAAGG No data
1072619646_1072619653 12 Left 1072619646 10:97071285-97071307 CCAGATGGAGGCAGGAAGGAGTG No data
Right 1072619653 10:97071320-97071342 CGTCCACAGAGTCAGGAAGGCGG No data
1072619646_1072619651 5 Left 1072619646 10:97071285-97071307 CCAGATGGAGGCAGGAAGGAGTG No data
Right 1072619651 10:97071313-97071335 CTGAGGACGTCCACAGAGTCAGG No data
1072619646_1072619657 25 Left 1072619646 10:97071285-97071307 CCAGATGGAGGCAGGAAGGAGTG No data
Right 1072619657 10:97071333-97071355 AGGAAGGCGGGACCTCCAGTGGG No data
1072619646_1072619656 24 Left 1072619646 10:97071285-97071307 CCAGATGGAGGCAGGAAGGAGTG No data
Right 1072619656 10:97071332-97071354 CAGGAAGGCGGGACCTCCAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1072619646 Original CRISPR CACTCCTTCCTGCCTCCATC TGG (reversed) Intronic