ID: 1072619650

View in Genome Browser
Species Human (GRCh38)
Location 10:97071312-97071334
Sequence CTGACTCTGTGGACGTCCTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1072619650_1072619657 -2 Left 1072619650 10:97071312-97071334 CCTGAGGACGTCCACAGAGTCAG No data
Right 1072619657 10:97071333-97071355 AGGAAGGCGGGACCTCCAGTGGG No data
1072619650_1072619656 -3 Left 1072619650 10:97071312-97071334 CCTGAGGACGTCCACAGAGTCAG No data
Right 1072619656 10:97071332-97071354 CAGGAAGGCGGGACCTCCAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1072619650 Original CRISPR CTGACTCTGTGGACGTCCTC AGG (reversed) Intronic