ID: 1072619657

View in Genome Browser
Species Human (GRCh38)
Location 10:97071333-97071355
Sequence AGGAAGGCGGGACCTCCAGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1072619646_1072619657 25 Left 1072619646 10:97071285-97071307 CCAGATGGAGGCAGGAAGGAGTG 0: 1
1: 0
2: 3
3: 42
4: 388
Right 1072619657 10:97071333-97071355 AGGAAGGCGGGACCTCCAGTGGG No data
1072619650_1072619657 -2 Left 1072619650 10:97071312-97071334 CCTGAGGACGTCCACAGAGTCAG 0: 1
1: 0
2: 1
3: 11
4: 102
Right 1072619657 10:97071333-97071355 AGGAAGGCGGGACCTCCAGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1072619657 Original CRISPR AGGAAGGCGGGACCTCCAGT GGG Intronic
No off target data available for this crispr