ID: 1072621684

View in Genome Browser
Species Human (GRCh38)
Location 10:97083953-97083975
Sequence GCTCCTGGGTGGTGGCCCAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1072621684_1072621698 30 Left 1072621684 10:97083953-97083975 CCTCTGGGCCACCACCCAGGAGC No data
Right 1072621698 10:97084006-97084028 CCCCAGTCTTCATCTAGTTGTGG No data
1072621684_1072621693 0 Left 1072621684 10:97083953-97083975 CCTCTGGGCCACCACCCAGGAGC No data
Right 1072621693 10:97083976-97083998 CCTCAGCAGGAGTGACACCAGGG No data
1072621684_1072621691 -1 Left 1072621684 10:97083953-97083975 CCTCTGGGCCACCACCCAGGAGC No data
Right 1072621691 10:97083975-97083997 CCCTCAGCAGGAGTGACACCAGG No data
1072621684_1072621694 7 Left 1072621684 10:97083953-97083975 CCTCTGGGCCACCACCCAGGAGC No data
Right 1072621694 10:97083983-97084005 AGGAGTGACACCAGGGCTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1072621684 Original CRISPR GCTCCTGGGTGGTGGCCCAG AGG (reversed) Intronic