ID: 1072623812

View in Genome Browser
Species Human (GRCh38)
Location 10:97098364-97098386
Sequence CCAAGCTGCTAGGCAGAGAG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1072623801_1072623812 29 Left 1072623801 10:97098312-97098334 CCCAACTCAGAGCTGGGGAAGAC 0: 1
1: 0
2: 1
3: 24
4: 214
Right 1072623812 10:97098364-97098386 CCAAGCTGCTAGGCAGAGAGGGG No data
1072623802_1072623812 28 Left 1072623802 10:97098313-97098335 CCAACTCAGAGCTGGGGAAGACA 0: 1
1: 0
2: 1
3: 31
4: 218
Right 1072623812 10:97098364-97098386 CCAAGCTGCTAGGCAGAGAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1072623812 Original CRISPR CCAAGCTGCTAGGCAGAGAG GGG Intronic
No off target data available for this crispr