ID: 1072624280

View in Genome Browser
Species Human (GRCh38)
Location 10:97101063-97101085
Sequence CAGTGTCCCCAAGGGGACTG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1072624274_1072624280 -10 Left 1072624274 10:97101050-97101072 CCCTTAACGTTGCCAGTGTCCCC 0: 1
1: 0
2: 0
3: 2
4: 68
Right 1072624280 10:97101063-97101085 CAGTGTCCCCAAGGGGACTGTGG No data
1072624272_1072624280 9 Left 1072624272 10:97101031-97101053 CCTTCCTGCTGGCACTGAGCCCT 0: 1
1: 0
2: 6
3: 38
4: 372
Right 1072624280 10:97101063-97101085 CAGTGTCCCCAAGGGGACTGTGG No data
1072624270_1072624280 11 Left 1072624270 10:97101029-97101051 CCCCTTCCTGCTGGCACTGAGCC 0: 1
1: 0
2: 2
3: 54
4: 341
Right 1072624280 10:97101063-97101085 CAGTGTCCCCAAGGGGACTGTGG No data
1072624273_1072624280 5 Left 1072624273 10:97101035-97101057 CCTGCTGGCACTGAGCCCTTAAC 0: 1
1: 0
2: 1
3: 30
4: 168
Right 1072624280 10:97101063-97101085 CAGTGTCCCCAAGGGGACTGTGG No data
1072624271_1072624280 10 Left 1072624271 10:97101030-97101052 CCCTTCCTGCTGGCACTGAGCCC 0: 1
1: 0
2: 2
3: 38
4: 340
Right 1072624280 10:97101063-97101085 CAGTGTCCCCAAGGGGACTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1072624280 Original CRISPR CAGTGTCCCCAAGGGGACTG TGG Intronic
No off target data available for this crispr