ID: 1072628223

View in Genome Browser
Species Human (GRCh38)
Location 10:97128095-97128117
Sequence GCCTTCTTCCCGCCCTTCCT CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1072628217_1072628223 9 Left 1072628217 10:97128063-97128085 CCGAGCCCCCTGCTCTCGGGCCT No data
Right 1072628223 10:97128095-97128117 GCCTTCTTCCCGCCCTTCCTCGG No data
1072628218_1072628223 4 Left 1072628218 10:97128068-97128090 CCCCCTGCTCTCGGGCCTTGCAT No data
Right 1072628223 10:97128095-97128117 GCCTTCTTCCCGCCCTTCCTCGG No data
1072628221_1072628223 1 Left 1072628221 10:97128071-97128093 CCTGCTCTCGGGCCTTGCATTGA No data
Right 1072628223 10:97128095-97128117 GCCTTCTTCCCGCCCTTCCTCGG No data
1072628220_1072628223 2 Left 1072628220 10:97128070-97128092 CCCTGCTCTCGGGCCTTGCATTG No data
Right 1072628223 10:97128095-97128117 GCCTTCTTCCCGCCCTTCCTCGG No data
1072628219_1072628223 3 Left 1072628219 10:97128069-97128091 CCCCTGCTCTCGGGCCTTGCATT No data
Right 1072628223 10:97128095-97128117 GCCTTCTTCCCGCCCTTCCTCGG No data
1072628215_1072628223 12 Left 1072628215 10:97128060-97128082 CCACCGAGCCCCCTGCTCTCGGG No data
Right 1072628223 10:97128095-97128117 GCCTTCTTCCCGCCCTTCCTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1072628223 Original CRISPR GCCTTCTTCCCGCCCTTCCT CGG Intronic