ID: 1072631420

View in Genome Browser
Species Human (GRCh38)
Location 10:97149444-97149466
Sequence CATGGCTCTCACATTGAACC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1072631416_1072631420 -8 Left 1072631416 10:97149429-97149451 CCTTCCCTTACTTAGCATGGCTC 0: 1
1: 0
2: 0
3: 8
4: 113
Right 1072631420 10:97149444-97149466 CATGGCTCTCACATTGAACCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1072631420 Original CRISPR CATGGCTCTCACATTGAACC GGG Intronic
No off target data available for this crispr