ID: 1072631938

View in Genome Browser
Species Human (GRCh38)
Location 10:97152244-97152266
Sequence TTTTTTTTCTCGAGGGGCTT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 364
Summary {0: 1, 1: 0, 2: 1, 3: 22, 4: 340}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1072631938_1072631950 16 Left 1072631938 10:97152244-97152266 CCTAAGCCCCTCGAGAAAAAAAA 0: 1
1: 0
2: 1
3: 22
4: 340
Right 1072631950 10:97152283-97152305 GGAAGGTCCCTGCAAATTGAGGG No data
1072631938_1072631951 17 Left 1072631938 10:97152244-97152266 CCTAAGCCCCTCGAGAAAAAAAA 0: 1
1: 0
2: 1
3: 22
4: 340
Right 1072631951 10:97152284-97152306 GAAGGTCCCTGCAAATTGAGGGG No data
1072631938_1072631949 15 Left 1072631938 10:97152244-97152266 CCTAAGCCCCTCGAGAAAAAAAA 0: 1
1: 0
2: 1
3: 22
4: 340
Right 1072631949 10:97152282-97152304 GGGAAGGTCCCTGCAAATTGAGG No data
1072631938_1072631952 21 Left 1072631938 10:97152244-97152266 CCTAAGCCCCTCGAGAAAAAAAA 0: 1
1: 0
2: 1
3: 22
4: 340
Right 1072631952 10:97152288-97152310 GTCCCTGCAAATTGAGGGGATGG No data
1072631938_1072631944 -6 Left 1072631938 10:97152244-97152266 CCTAAGCCCCTCGAGAAAAAAAA 0: 1
1: 0
2: 1
3: 22
4: 340
Right 1072631944 10:97152261-97152283 AAAAAAACAAAACCCTGTTGGGG No data
1072631938_1072631942 -8 Left 1072631938 10:97152244-97152266 CCTAAGCCCCTCGAGAAAAAAAA 0: 1
1: 0
2: 1
3: 22
4: 340
Right 1072631942 10:97152259-97152281 AAAAAAAAACAAAACCCTGTTGG No data
1072631938_1072631945 -5 Left 1072631938 10:97152244-97152266 CCTAAGCCCCTCGAGAAAAAAAA 0: 1
1: 0
2: 1
3: 22
4: 340
Right 1072631945 10:97152262-97152284 AAAAAACAAAACCCTGTTGGGGG No data
1072631938_1072631946 -1 Left 1072631938 10:97152244-97152266 CCTAAGCCCCTCGAGAAAAAAAA 0: 1
1: 0
2: 1
3: 22
4: 340
Right 1072631946 10:97152266-97152288 AACAAAACCCTGTTGGGGGAAGG No data
1072631938_1072631943 -7 Left 1072631938 10:97152244-97152266 CCTAAGCCCCTCGAGAAAAAAAA 0: 1
1: 0
2: 1
3: 22
4: 340
Right 1072631943 10:97152260-97152282 AAAAAAAACAAAACCCTGTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1072631938 Original CRISPR TTTTTTTTCTCGAGGGGCTT AGG (reversed) Intronic
900374499 1:2347276-2347298 TTTCCTTTCTAGAGGCGCTTTGG - Intronic
900906157 1:5560416-5560438 TTTTTTTTCCCCAGGTGGTTTGG - Intergenic
901238061 1:7678165-7678187 TCCTCTTTCTCGAGAGGCTTGGG - Intronic
902138365 1:14330717-14330739 TTTTTTTTTTCCAGTTGCTTGGG - Intergenic
902642033 1:17773088-17773110 CCTATCTTCTCGAGGGGCTTCGG - Intronic
906290134 1:44614386-44614408 TGTCTTTTCCCGAGGGGCTGGGG - Intronic
906530926 1:46523583-46523605 TTTTTTTTTAAGTGGGGCTTTGG + Intergenic
908109880 1:60886234-60886256 TTTATTTTCTCCAGGTGATTAGG - Intronic
908597090 1:65699775-65699797 TTCTTTCTCTCTAGGGTCTTTGG + Intergenic
910177068 1:84442467-84442489 TTTTTTTTCTTTAGTGGTTTTGG - Intergenic
910563416 1:88617617-88617639 TTCTTTTTCTTCAGGAGCTTTGG - Intergenic
910771787 1:90838607-90838629 TTTTTTCTCACCATGGGCTTTGG + Intergenic
910994343 1:93088113-93088135 ATTTTTTTCTCGTTGGTCTTAGG + Intronic
911725327 1:101236566-101236588 TTTTTTTTTTTCAGGGGCTCGGG + Intergenic
912658175 1:111506039-111506061 TTTGTTTTCTAGATGGACTTGGG - Intronic
914243181 1:145866523-145866545 TTTTTTTTCTAAAGGGGAGTGGG - Intergenic
915561415 1:156690323-156690345 CTTATTTTCTCAAGGGGCTCAGG - Intergenic
916419964 1:164627803-164627825 TTTTTTTTCTCCAGTGGGCTTGG + Intronic
918371748 1:183868043-183868065 TTTTGTTTTTAGAAGGGCTTGGG + Intronic
918673081 1:187245236-187245258 TTTTTTTTCTCACTGGGCATTGG + Intergenic
918875957 1:190043868-190043890 TTTTTAGTCTCAAGGTGCTTGGG + Intergenic
919592921 1:199526962-199526984 TTGTTTTTCTAGAGGCTCTTGGG - Intergenic
920546688 1:206824109-206824131 TTATTTCTCTCCAGAGGCTTGGG + Intronic
922427739 1:225515157-225515179 TTTTTTTTTTCATGGGGATTTGG + Intronic
923236101 1:232034886-232034908 TTTTTTTTTTTAAGAGGCTTTGG - Intronic
924026811 1:239842217-239842239 TTTTTTTTTTTGAGGGGGTTGGG + Intronic
1063316617 10:5012614-5012636 TATTTTTTCTTGAGGGTCTAGGG - Intronic
1063668375 10:8080028-8080050 TTTTTTGTTTTGAGGGGATTGGG + Intergenic
1063951625 10:11228705-11228727 TTTTTTTTTGCGAGGGGCGCGGG - Intronic
1065293816 10:24256389-24256411 TTTTTATTTTCTATGGGCTTTGG - Intronic
1066129375 10:32377001-32377023 TTTTTGTTCTTGGGAGGCTTTGG + Intronic
1066468174 10:35671371-35671393 TTTTTTTTCTGGGGAGGCTGAGG + Intergenic
1067805458 10:49389360-49389382 TCTTTTTTATGTAGGGGCTTGGG - Intronic
1068123240 10:52806286-52806308 TTTCTTTTTTCCAGGGACTTGGG + Intergenic
1070182422 10:74027162-74027184 TTTTTATTCTGGTGGGGCTCTGG + Intronic
1070233296 10:74595385-74595407 TTTTTTTTGGGGAGGGGGTTTGG + Intronic
1072579939 10:96731915-96731937 TTTTTTTTCTGGAAGCGCCTGGG + Intergenic
1072631938 10:97152244-97152266 TTTTTTTTCTCGAGGGGCTTAGG - Intronic
1073314244 10:102567310-102567332 TTTTTTTTCTTGACAGGTTTTGG - Intronic
1074719696 10:116253695-116253717 TTTTTATTTTAGAGAGGCTTAGG - Intronic
1075313223 10:121431947-121431969 TTTTTTTTTTTGAGGCACTTGGG + Intergenic
1075517881 10:123123792-123123814 TTTTATTTTTCCAGGGGCTGGGG - Intergenic
1075597032 10:123739600-123739622 TTTTCTTTCTCCAGTGGCCTGGG + Intronic
1076905125 10:133357625-133357647 TTTTTCTTCTCCTGGGGCCTGGG - Intronic
1077829915 11:5855846-5855868 TTTTTTTTCTTCAGGAGATTTGG - Intronic
1077912487 11:6585558-6585580 TCTTTTTTTTGGAGGGGGTTGGG - Intronic
1079776131 11:24530776-24530798 TTTTTTTTTTGGTGGGGTTTAGG + Intronic
1079942567 11:26699584-26699606 TTGTTTTTCTTGGTGGGCTTTGG + Intronic
1080885205 11:36361879-36361901 TCTCTTCCCTCGAGGGGCTTGGG + Intronic
1082284228 11:50301930-50301952 TTTTTTTTCTCCAGGGCTTGAGG + Intergenic
1082873705 11:57967230-57967252 TTTTTTTTTTGAAGGGGGTTAGG + Intergenic
1084264703 11:67998895-67998917 TTTTTTTTTTGGTGGGGGTTGGG - Intronic
1086037173 11:82430840-82430862 TGTTTTCTCTCAAGGGGATTTGG - Intergenic
1086891895 11:92268041-92268063 TTTTTTTTTTTGAAGGACTTAGG - Intergenic
1087027121 11:93661111-93661133 TTTTTTTTTTAGACAGGCTTTGG + Intergenic
1087153848 11:94882243-94882265 TGTCTTTTCTGGAGAGGCTTGGG - Intergenic
1087284582 11:96251350-96251372 TTTTTTTTCTCTAAGGTATTGGG + Intronic
1087674672 11:101146620-101146642 TTTTTTTTCGCGGGGGGGTGAGG - Intergenic
1088658743 11:112026238-112026260 TTTTTTTTCCCAACGGGCTATGG - Exonic
1088666053 11:112094791-112094813 TTCTTTTTCTTTAGGGGCCTTGG + Intronic
1088678781 11:112221781-112221803 TTTTTTTGGTGGGGGGGCTTGGG + Intronic
1089109269 11:116042169-116042191 TTTTTTTTCTTGAGGGGCAGGGG + Intergenic
1090617874 11:128532661-128532683 TTTTTTTTCCCCAGTGACTTTGG + Intronic
1092047811 12:5444670-5444692 TTTTTTTTTCCCAGGGGCATGGG + Intronic
1092311139 12:7354916-7354938 TTTTTTTTTGCGAGGGGCAAAGG + Intronic
1092994014 12:13930823-13930845 TTTTTTTTGTTGGGGGGCTGTGG - Intronic
1095168526 12:39004819-39004841 TTTCTTTTCTCTAGGGTATTGGG - Intergenic
1095205040 12:39430176-39430198 TTTTTTTTTTCCAGGGTCTTAGG - Intronic
1096017273 12:48288368-48288390 TTTTTTTTCTCAAGGGTTGTGGG + Intergenic
1096060201 12:48692010-48692032 TTTTTTTTCAAGTGAGGCTTTGG - Exonic
1099027546 12:77484389-77484411 GTTTTTTTCTTGGGGGGCTGGGG - Intergenic
1099119613 12:78672021-78672043 TTTTTTTTTTGGAGGGGGTAGGG + Intergenic
1100313560 12:93421198-93421220 TTTTTTTTTTGGGGGGGCTGGGG + Intronic
1100782567 12:98044924-98044946 TTTTTTTTTTCGATAGGCTTGGG - Intergenic
1101735775 12:107461778-107461800 TTTTCTTTCTCTGGAGGCTTTGG - Intronic
1102059318 12:109920856-109920878 TTTTTTTTCTGATGGGGGTTTGG - Intronic
1105241346 13:18611653-18611675 TTTTTTTTCTCCACGGCCTGAGG - Intergenic
1106269963 13:28143121-28143143 TTTTTTTTGAGGAGGGGGTTGGG + Intronic
1107246289 13:38300216-38300238 TTTATTTTCTGGAGTGCCTTGGG - Intergenic
1107367916 13:39705637-39705659 TTTTTTTTCTCCAGAGGACTGGG - Intronic
1107931500 13:45311348-45311370 TTTTTTTTTTTGAGGGGCGGAGG + Intergenic
1109019666 13:57072592-57072614 CTTTTATTCTCTAGCGGCTTTGG + Intergenic
1111358569 13:87144388-87144410 TTTTTTTTCACGAGTTGGTTTGG - Intergenic
1111682496 13:91460763-91460785 TTTTTTTTTTCTATAGGCTTGGG + Intronic
1113692394 13:112320733-112320755 TGTTTTTTTTGGAGGGGCTCAGG - Intergenic
1114916402 14:27272109-27272131 TTTTTTTTCTTGATGGCCTTCGG - Intergenic
1115438737 14:33407320-33407342 TTCTTTTTCTCTAGGGATTTTGG + Intronic
1116048940 14:39780550-39780572 TTTTTTTTTTTGAGGGGGTACGG + Intergenic
1116330990 14:43597663-43597685 TTTTTTTTCTCATGGGGATTTGG + Intergenic
1116682209 14:47986716-47986738 CTTTTTTTCTCTTGGGCCTTAGG - Intergenic
1116944725 14:50825938-50825960 TTTTTTTTCTAAAGCAGCTTTGG + Intronic
1117268720 14:54118337-54118359 TTTTTTTTTTTGAGGTGGTTTGG - Intergenic
1117577181 14:57111224-57111246 TTTTTTTTCTGGAGGGCATGTGG - Intergenic
1117601228 14:57377256-57377278 TTTCTTTTCTTGAGGGACTGTGG + Intergenic
1117640861 14:57798106-57798128 TTTTTTTGCTCGTGGGTCTGTGG - Intronic
1118563974 14:67118840-67118862 TTTTTCTTCTCAAGTGCCTTCGG + Intronic
1118749095 14:68793761-68793783 TTTTTTTTCCAGCGGGGCGTAGG + Intronic
1119055795 14:71418631-71418653 TAATGTTTCTCGAAGGGCTTAGG + Intronic
1119171663 14:72540478-72540500 TTTTTTTTTTCGATGAGCTATGG - Intronic
1120052565 14:79884208-79884230 TTTCTTTTCTTGACAGGCTTTGG + Intergenic
1120080654 14:80212338-80212360 TTTTTTTTTTAGAAGGGGTTGGG + Intronic
1120197238 14:81497734-81497756 TTTTTTTTTTTAAGGGGCTCAGG + Intronic
1121088264 14:91163285-91163307 TTTGTTCTCACAAGGGGCTTTGG + Intronic
1121336340 14:93079636-93079658 TTTATTTTCCCGAGAGGCTGTGG - Intronic
1122056526 14:99102046-99102068 TTTTTTTTTGCGAGAGGCCTAGG - Intergenic
1125632110 15:41155740-41155762 TTTTTTTCCTCGGGAGGCTGAGG - Intergenic
1126459390 15:48899030-48899052 TTTTTTTTCTAAATGAGCTTTGG - Intronic
1127634800 15:60858987-60859009 TTTTTTTTTCCTGGGGGCTTGGG + Intronic
1129635421 15:77311674-77311696 TTTTTTTTTTTGTGGGGGTTGGG - Intronic
1130604655 15:85305332-85305354 TTTTTTTTCTCTTTGGGTTTTGG + Intergenic
1131493271 15:92881481-92881503 TTTTTTTAGAGGAGGGGCTTAGG - Intergenic
1131501879 15:92975826-92975848 ATTTACTTCTTGAGGGGCTTGGG + Intronic
1132206657 15:99990635-99990657 TTTTTTTACTCAAAGGGTTTGGG + Intronic
1202954842 15_KI270727v1_random:69798-69820 TTTTTTTTCTCCACGGCCTGAGG + Intergenic
1135288801 16:21216994-21217016 TTTTTTTTTTGGCAGGGCTTTGG + Intergenic
1137530810 16:49277735-49277757 TTTATTTCCTCTAGGGGCGTGGG - Intergenic
1137916632 16:52438644-52438666 TTTTTTTTCTGGAGAGATTTAGG + Exonic
1138315518 16:56066483-56066505 TGTTTTTTCACAAGGGGCTCAGG - Intergenic
1138538365 16:57672742-57672764 TCATTTTGCTCGAGGGGCCTTGG + Intronic
1139079235 16:63494675-63494697 TTATTATTTTCAAGGGGCTTAGG - Intergenic
1139593714 16:67946695-67946717 GTTTTGTTCCCGAGGGGCCTTGG - Intronic
1140760364 16:78103682-78103704 TTGTTTTTCTCTTGGGGTTTGGG + Intronic
1146015742 17:29232119-29232141 TTTTTTTTCTGGAGGCTCTAGGG - Intergenic
1146790371 17:35747407-35747429 TTTCTTTACGGGAGGGGCTTAGG + Intronic
1146910562 17:36645878-36645900 TTTCTTTTGTCGAGGTGATTGGG - Intergenic
1148553657 17:48565083-48565105 CTTTTTTTCTCTAGGGACCTGGG - Intronic
1152841691 17:82573232-82573254 TTTCCTTTGTGGAGGGGCTTGGG + Intronic
1153430512 18:5011276-5011298 TTTTTTTTCTTGAGATGGTTTGG - Intergenic
1154447612 18:14448253-14448275 TTTTTTTTCTCCACGGCCTGAGG + Intergenic
1156220241 18:35043867-35043889 TTATTTTTTTGGAGGGGCATAGG + Intronic
1157262766 18:46190487-46190509 TTTTTTTTTTCGGGGGGCCGGGG - Intronic
1159233748 18:65644092-65644114 TTTTTTTTTTAGAGAAGCTTAGG + Intergenic
1159332877 18:67023784-67023806 TTTTTTTTCTCTATCTGCTTGGG - Intergenic
1159521712 18:69533123-69533145 TTTTTTTTCTGGAGGTGCAAAGG - Intronic
1159988908 18:74878876-74878898 TTTTTTTTTTGGAGTGGGTTGGG - Intronic
1160285934 18:77543461-77543483 TTTTTTTTTTCTGGGGGCTTGGG + Intergenic
1160433180 18:78826336-78826358 GGTTTCTTTTCGAGGGGCTTAGG - Intergenic
1160787764 19:909226-909248 TGTTTTTGCTCGAGGGACTGAGG - Intronic
1162369354 19:10269778-10269800 ATTTTTTTCTTGGGGGGCTGAGG - Intergenic
1162960232 19:14121286-14121308 TTTTTTTTTTTGCGGGGGTTAGG + Intronic
1163131820 19:15278531-15278553 TTTTTTTTTTGGCGGGGGTTGGG - Intronic
1163833110 19:19557066-19557088 TTTTTTTTTTTGAGGGGAATGGG - Intergenic
1163895675 19:20056895-20056917 TTTTTTTTTTGGAGGGGGATGGG + Intergenic
1166094759 19:40531620-40531642 GTTTTTTACTGGAGGGGGTTGGG + Intronic
1167172713 19:47843872-47843894 TGTTTTTTCGGGAGGGGCATTGG - Intergenic
926423464 2:12719581-12719603 TTTTTTTTTTTGAGGGGGTAAGG + Intronic
928087238 2:28353366-28353388 TTTTTTTTTTGGAGGGGGTGCGG + Intergenic
928236849 2:29549962-29549984 ACTTTTTTATCCAGGGGCTTAGG - Intronic
929321868 2:40553813-40553835 TTTTTATTCTCTAAGGACTTTGG + Intronic
930766420 2:55090065-55090087 TTTTTTTTCTCCTGAGTCTTTGG + Intronic
931915021 2:66944808-66944830 CTTTTTTTTTGGAGGGGCCTTGG - Intergenic
932263532 2:70346597-70346619 TTCTTGTTCTAAAGGGGCTTGGG - Intergenic
933168593 2:79100055-79100077 TTTTTTTTTTGGTGGGGGTTTGG - Intergenic
933738171 2:85512065-85512087 TTTTTTTTTTGGAGGGGGTGGGG + Intergenic
934518416 2:95004161-95004183 TTTTTTTTCTTAAAGTGCTTTGG + Intergenic
935053353 2:99543555-99543577 TTTTTTTCCTCTAGGAGGTTAGG - Intergenic
935719815 2:105970071-105970093 TTTTTTTTCACGAGGCCCTCAGG - Intergenic
936480932 2:112884160-112884182 TTTTTTTTCTGGAGTAGTTTTGG + Intergenic
939110000 2:137995193-137995215 TTTTTTTTTTGGAGGGTTTTTGG - Intronic
939680642 2:145127929-145127951 TTTTTTTTTTGGGGGGGGTTTGG + Intergenic
940756100 2:157684892-157684914 TTTTTTTTTTGGAGGAGCTGTGG - Intergenic
944382844 2:199131587-199131609 TTTTTTTCCTCGATGGAGTTAGG - Intergenic
944966895 2:204945227-204945249 TTTGTTTTCCTGAGGGGCTCTGG + Intronic
945919546 2:215741705-215741727 ATTTTTTTCTCGGGAGGTTTTGG - Intergenic
947880009 2:233499798-233499820 TTTTTTTTCTCCAGGGTTGTAGG - Intronic
948022226 2:234744209-234744231 TTTTTTTTCTCAAGGATCTTTGG - Intergenic
948626833 2:239274755-239274777 TTTCTTTTCTGGAGCAGCTTTGG - Intronic
1169802472 20:9524480-9524502 TTTTTTTTCCCGTGGGTCATAGG + Intronic
1170071428 20:12373439-12373461 TTTTATTTGTCAAGGGTCTTAGG + Intergenic
1170683594 20:18548249-18548271 TTTTTTTTTTAAAGGGCCTTTGG - Intronic
1171901990 20:30866873-30866895 TTTTTTTTTTTGTGGGGGTTGGG + Intergenic
1173060885 20:39659952-39659974 TTTTTTTTCTTAAGGGACCTAGG - Intergenic
1173075570 20:39815812-39815834 ATTTTTTTCTAGAGAAGCTTTGG - Intergenic
1174284818 20:49465083-49465105 TTTTTATACAAGAGGGGCTTGGG + Intronic
1175802881 20:61811163-61811185 TTTTTTTTCTCTAAGAGTTTGGG - Intronic
1176020276 20:62959099-62959121 TTTGTTTACTGGAGGGTCTTCGG + Intronic
1176448585 21:6842409-6842431 TTTTTTTTCTCCACGGCCTGAGG - Intergenic
1176826755 21:13707431-13707453 TTTTTTTTCTCCACGGCCTGAGG - Intergenic
1177244626 21:18507243-18507265 TTTTTTCTTTTGAGGGGTTTTGG + Intergenic
1177881733 21:26702600-26702622 TTTTTTTTCTCCTAGGGCTCTGG + Intergenic
1178232276 21:30799860-30799882 TTTTTTTTCTGGCGGGGGATGGG + Intergenic
1178295934 21:31409887-31409909 TTTTTTTTATTTGGGGGCTTGGG + Intronic
1178681379 21:34675240-34675262 TTTTTTTTTTGGAGGGGCGGGGG - Intronic
1180335365 22:11572806-11572828 TTTTTTTTTTTGTGGGGGTTGGG + Intergenic
1182757786 22:32694319-32694341 TTTTTATTCTCTAGTGGTTTAGG + Intronic
1183621050 22:38972947-38972969 TCATTTTTCTCTAAGGGCTTGGG - Intronic
1183877783 22:40798624-40798646 TTATTTTTCTAGAGGGGATAGGG - Intronic
949414851 3:3802459-3802481 TTTTTTTTCTGGCGGGGGTTGGG - Intronic
950087119 3:10267259-10267281 TTTTTTTTGTCGGGGGGTGTGGG - Intronic
950246416 3:11423620-11423642 TTTTTTTTTTCCAGGGGGTTAGG + Intronic
950692381 3:14670139-14670161 TTTTTTTTCTAGAAGCACTTGGG + Intronic
950798770 3:15532380-15532402 TTTTTTTTCTTGTAGGGCATGGG + Intergenic
951074190 3:18369308-18369330 TTTTTTTTGTGGAGGGGGGTGGG - Intronic
951139127 3:19140940-19140962 TTATTTTTATAGAGGGGATTTGG + Intergenic
951958964 3:28293312-28293334 TTTTTTTTTTCGAGTGGCTGGGG + Intronic
952958058 3:38571883-38571905 GTTTTTTTCTCCAGTGGTTTTGG + Intronic
954458518 3:50612712-50612734 TTTTTTTTCTGGCGGGGGGTGGG - Intronic
955071248 3:55574345-55574367 TTTGTTTTATCAAGGGACTTTGG - Intronic
955973282 3:64457199-64457221 TTTTTTTTTTCCAGGGCTTTGGG + Intergenic
956199086 3:66687619-66687641 TTATTTTTCTCCAGGGGCTTGGG + Intergenic
956975927 3:74579353-74579375 TTTTTTTTTTTGAGGGGGGTGGG - Intergenic
957387428 3:79515015-79515037 TTTTTTTTCTTGAGTGTTTTTGG + Intronic
958682255 3:97346086-97346108 TTTTTTTTCCAGAGGGGTTGGGG + Intronic
959292478 3:104492004-104492026 TTTTTTTTTTCGGGGGGGTTGGG - Intergenic
959640318 3:108625156-108625178 TTTTTTTTCTAGAGAGACTGAGG + Intronic
960125794 3:113997092-113997114 ATTTTTTTCTCGTTGGGGTTTGG + Intronic
960163917 3:114380491-114380513 TTTTTTTTCTGAAGGGGGATGGG + Intronic
960684856 3:120285616-120285638 TTTTATTTCTGGAGTGGCGTCGG + Intergenic
963091887 3:141489974-141489996 TTTTTTTTGCCGGGGGGCTGGGG + Intronic
963690578 3:148496254-148496276 TATTTTTTCTTGAAGGGGTTAGG + Intergenic
963781502 3:149491281-149491303 TTTTTTTTGTAGAGGGGCGCTGG - Intronic
964672248 3:159239449-159239471 TTTTTTTTCTCTGGGGACTTAGG - Intronic
964790829 3:160452337-160452359 TTATTTTTCTCCATGGGCTCAGG - Intronic
964856462 3:161151059-161151081 AATTTCTTCTCAAGGGGCTTTGG - Intronic
964898564 3:161628714-161628736 TTTGTTTACTTGAGGGTCTTGGG + Intergenic
965355346 3:167666583-167666605 TTTTTTTTCTGGTGGGGGATGGG + Intergenic
966719347 3:183045889-183045911 TTCTTTTTCTCCATGGGGTTAGG - Intronic
966777280 3:183553966-183553988 TTTTTTTTTTTGAGGTGCTTGGG - Intronic
967066817 3:185925219-185925241 TTTTTTTTTTTGATGGGCTAAGG + Intronic
967092378 3:186146010-186146032 TTTTTTTTGGCCAGGGGCTGGGG - Intronic
967647761 3:191947280-191947302 TTTTTTTTTTGGGGGGGCTGGGG + Intergenic
969192912 4:5536836-5536858 TTTTCTTTCTCCTGAGGCTTTGG - Intergenic
970451706 4:16173532-16173554 TTTTTTTACTCGGGAGGCTGAGG - Intronic
970872079 4:20827797-20827819 TTTTTTTTTTTGAGGGGGATGGG - Intronic
971150661 4:24028106-24028128 TTTTTTTCCTTGAGGAGCCTTGG - Intergenic
971932244 4:33099580-33099602 TTTTTTTTTTTGAGGGGCGTGGG - Intergenic
972101934 4:35431362-35431384 TTTTTTTTCTCCTAGGGCTCTGG - Intergenic
973584525 4:52377182-52377204 TAATTTTTCTTTAGGGGCTTTGG - Intergenic
974214561 4:58828303-58828325 TTTTTTTTCTCCTAGGGCTCTGG + Intergenic
975177776 4:71308176-71308198 TTTTTTTTCTCAAAGCACTTCGG - Intronic
975586852 4:75958787-75958809 TTTTTTTTTTTAAAGGGCTTTGG - Intronic
976028320 4:80719383-80719405 TTTTGTTTCTCTTGGGTCTTAGG + Intronic
977258135 4:94762861-94762883 TTTTTTTTTTTGCGGGGCTGGGG + Intronic
977295754 4:95206910-95206932 TTTTTTTTTTCTGGGGGGTTGGG + Intronic
977410805 4:96659891-96659913 TTTTTTTTTTGGTGAGGCTTTGG + Intergenic
977758855 4:100706110-100706132 TTTTTATTCTCCAAGGGTTTGGG - Intronic
978019873 4:103794219-103794241 TTTTTTTTCTCAATGGTTTTGGG - Intergenic
978298920 4:107242909-107242931 ATTTTTTTTTGGAGGGGATTGGG + Intronic
979887855 4:126053279-126053301 TTTTTTTTATCAAAGAGCTTTGG + Intergenic
980286842 4:130790502-130790524 TTTTTTTTTTTGAGGGGAGTGGG + Intergenic
981640538 4:146938704-146938726 TTATTTTGTTCCAGGGGCTTTGG + Intronic
981714348 4:147738023-147738045 TTTTTTTTTTTGAGGGGACTAGG + Intronic
982312468 4:154000517-154000539 TTTTTGTTCTGGATGGGCTTGGG - Intergenic
982587697 4:157263388-157263410 TTTTTTTTCTGTAGTGGCTCAGG + Intronic
982832302 4:160077983-160078005 TTTTTTTTTTAGAGGGAGTTTGG - Intergenic
983572800 4:169228389-169228411 TTTTTTTTCTGGAGGTTCTAGGG + Intronic
983775924 4:171607754-171607776 TCTTTTTTATTGATGGGCTTAGG + Intergenic
984189108 4:176583561-176583583 TCTTTTTTCTCAAGAAGCTTTGG + Intergenic
985009467 4:185567817-185567839 TTTTTTTTTTGGAGGGGGTGGGG + Intergenic
985737266 5:1591314-1591336 TTTTTTTTGCAGGGGGGCTTGGG + Intergenic
986597995 5:9443256-9443278 TTTGTTTTCTTGAGTGGCTGGGG - Intronic
986940153 5:12938667-12938689 TTTTTTTTCTTTAGTGGCTCTGG - Intergenic
989293677 5:39798175-39798197 TTTTTTTTTTCTATGAGCTTTGG - Intergenic
989329563 5:40240449-40240471 TTTTTTTTCTGGTGGGGCAGGGG + Intergenic
990234116 5:53748481-53748503 TTTTTTTTCTTGTCTGGCTTTGG - Intergenic
991517163 5:67449944-67449966 TTTTTTTTTTTGAGGGGCAAAGG + Intergenic
992916281 5:81456356-81456378 TTTTTTTTTTCATGTGGCTTGGG + Intronic
993053959 5:82958788-82958810 TATTTTTTCTCAAGGAGTTTTGG - Intergenic
994244688 5:97466586-97466608 TTTTTTTTCTCCAGTGTCTGAGG + Intergenic
995020341 5:107360183-107360205 TTTTTTTTTTCCAGTCGCTTTGG + Intergenic
995082586 5:108071058-108071080 TATTTTATCTCAAGGTGCTTTGG - Intronic
996528594 5:124503477-124503499 TTTGTTTTCTTGAGGGGATGGGG + Intergenic
997582357 5:135025965-135025987 TTTTTTTTTTCCAGAGGATTGGG + Intergenic
998886035 5:146694413-146694435 TTTTTTTTGTTGCGTGGCTTTGG + Intronic
998922980 5:147090618-147090640 TATTTTTTCTTGAGTGGCTTTGG + Intergenic
999266514 5:150270206-150270228 TTTTTTTAATGCAGGGGCTTGGG + Intronic
1000310087 5:160034137-160034159 TTTTTTTTTTTAAGGGACTTTGG + Intronic
1000882917 5:166717861-166717883 TTTTTTTCTTCCAGGGGGTTGGG + Intergenic
1000980046 5:167807109-167807131 TTTTTTTAACCTAGGGGCTTTGG - Intronic
1000993033 5:167930273-167930295 TTTTTTTAATCAAGGTGCTTAGG + Intronic
1001045588 5:168368998-168369020 TGTGTTTTCCCGTGGGGCTTAGG + Intronic
1001313390 5:170626775-170626797 TTTGTCTTCTGGAGGGGATTGGG + Intronic
1002404713 5:179021029-179021051 TTTTTTTTTTGGAGGGGGGTGGG + Intergenic
1003882406 6:10490519-10490541 TTTTTTTAAACGAGGGGCTCTGG + Intergenic
1005365487 6:25072050-25072072 TTTGTTTTCTCGCGGGGGTCGGG - Intergenic
1007564924 6:42842628-42842650 TTCATTTTTTCTAGGGGCTTTGG - Intronic
1007886561 6:45236587-45236609 TTTCTTTTCTGGAGGACCTTGGG + Intronic
1008694447 6:54017583-54017605 TTTTTTTTCTAGAGAGGTTTAGG + Intronic
1009924420 6:70102714-70102736 TTTTTTTTTTCTAGAAGCTTGGG - Intronic
1010172189 6:72987135-72987157 TTTTTCTTCTCGGGGGCCTTAGG - Intronic
1010254526 6:73742699-73742721 TCTTCTTTCTAGAGTGGCTTAGG + Intronic
1012665943 6:101970211-101970233 TTTTTTTTCTCTAGGATTTTTGG + Intronic
1013768469 6:113599962-113599984 TTTTTTTTCTCAAGGGCACTAGG - Intergenic
1014160364 6:118160903-118160925 TTTTTTTTTTTGAGGAGGTTGGG + Intronic
1014490588 6:122057107-122057129 TTTTTTTTCTCTAGAGCATTTGG - Intergenic
1014513749 6:122356641-122356663 ATTTTTTTCTTGAAGGGTTTTGG - Intergenic
1017965212 6:159258379-159258401 TTTTTTTTCTTTATGAGCTTGGG + Intronic
1018025411 6:159801822-159801844 TTTTTTTCCTTGATGGGATTTGG + Intronic
1018126683 6:160689709-160689731 TTTTCTTTTCCAAGGGGCTTAGG + Intergenic
1018402515 6:163439345-163439367 TTTTTTTTTTCGGGGGGGTGGGG + Intronic
1021102247 7:16597234-16597256 TTTTTTTTTTTAAGGGCCTTGGG + Intergenic
1022556734 7:31305704-31305726 TTTTTTTCCCCGAGGGGATTGGG - Intergenic
1022717695 7:32913771-32913793 TTTTTTTTTTGGTGGGGTTTGGG + Intergenic
1022733242 7:33051807-33051829 TTTATTTGCTAGAGAGGCTTTGG - Intronic
1022845709 7:34207587-34207609 ATTTTTTTTTTCAGGGGCTTGGG + Intergenic
1023158829 7:37278127-37278149 TTTTTTTTTTGGCGGGGCTGGGG + Intronic
1023899912 7:44467646-44467668 CTTTTTTTTTTTAGGGGCTTGGG - Intronic
1024282401 7:47730335-47730357 TTTTTTTTGCCGAGGAGCTCTGG + Intronic
1024496252 7:50049807-50049829 TTTTTTTTATTGAGGAGCCTAGG - Intronic
1025187277 7:56871098-56871120 TTTTTTTTCTCCAGGGCTTGAGG - Intergenic
1025684648 7:63705822-63705844 TTTTTTTTCTCCAGGGCTTGAGG + Intergenic
1026038456 7:66846253-66846275 CTTTTTTTCTCCAGGGCCTGGGG + Intergenic
1026600696 7:71774993-71775015 TTTTTTTTCTTATGGGGCCTTGG + Intergenic
1027212935 7:76165315-76165337 TTTTTTTTCTCCAGGACCTGGGG - Intergenic
1027377782 7:77571124-77571146 TTCTTTTTCTCCAGTGGCTGTGG - Exonic
1027753117 7:82177078-82177100 TTTTTTTTTTGGCGGGGGTTGGG + Intronic
1028315637 7:89398862-89398884 TTTTATATCTCCAGGTGCTTTGG - Intergenic
1029296253 7:99542943-99542965 TTTTTTTTTTGGCGGGGCCTGGG - Intergenic
1030820994 7:114090815-114090837 TTTTTTTTTTCATGAGGCTTAGG + Intronic
1030837390 7:114306748-114306770 TTTTTTTTCTGGAGGTGCAAGGG + Intronic
1031096081 7:117422647-117422669 TTTTTTTTCTCTAGGGGAGCTGG + Intronic
1032083921 7:128873808-128873830 TTTTTTTGGCCGGGGGGCTTGGG + Intronic
1032109956 7:129067555-129067577 TTTTCTTTCTCGGGGGAATTGGG + Intergenic
1034102275 7:148459943-148459965 CTTTGTTTACCGAGGGGCTTTGG + Intergenic
1035143704 7:156791066-156791088 TTTTTTTTCTTGAAGGTGTTGGG + Intronic
1036484397 8:9166169-9166191 TTTTGTTTCTAGAGAGGCATTGG + Intronic
1036569478 8:9967436-9967458 TTTTTTTTCTCCAGGTGAGTTGG + Intergenic
1036648713 8:10628378-10628400 TTGTTTTTCAGGAGGGGCATTGG - Intronic
1036803907 8:11814308-11814330 TTTTTTTTTTGGAGGGACATGGG + Intronic
1037539315 8:19856202-19856224 TTTTTTTTCCAGAGGGCCCTGGG - Intergenic
1037772160 8:21808705-21808727 TTGTTTTGCTGGAGGGGATTTGG - Intronic
1038836802 8:31135012-31135034 TTTTTTTGGTGGGGGGGCTTGGG - Intronic
1042840519 8:73118792-73118814 TTCTGTTTCTCAAGGGGGTTGGG + Intronic
1042955433 8:74244974-74244996 TTTTGCTTCTTCAGGGGCTTTGG + Exonic
1044734660 8:95267878-95267900 TTTTTTTTTTTGAGGGGTTGTGG + Intronic
1045462596 8:102439298-102439320 TTTTTTTTCTCAAAGGGATTTGG + Intergenic
1046304800 8:112351880-112351902 TTTTTTTTGTCGAGGGTCCCAGG - Intronic
1046613096 8:116446850-116446872 TTTTTTTTACCGAAGGGTTTGGG - Intergenic
1046780146 8:118205907-118205929 TTTTTTTTCCCCAAGGGCTGAGG - Intronic
1047568598 8:126073363-126073385 TTTTTCTTCGCGGGGGCCTTAGG - Intergenic
1048409538 8:134157611-134157633 TTGTTTTTCTCTAGATGCTTTGG + Intergenic
1051010729 9:12410612-12410634 TTTTTTTTTTGGCGGGGCTGGGG - Intergenic
1051022093 9:12556753-12556775 TTTTTTTTCTGGGGGCCCTTTGG + Intergenic
1051632913 9:19156744-19156766 TTTTTTTTTTCGGGGGGGTGGGG - Intergenic
1052823243 9:33156124-33156146 TTTTTTTTTTCGGGGGGCGGGGG + Intronic
1053489559 9:38488628-38488650 TTTTTTTTGGAGAGGGGATTAGG + Intergenic
1055098463 9:72438710-72438732 TTATTTTTCTCTATGAGCTTTGG - Intergenic
1055251569 9:74314081-74314103 TTTTTTTTCTTGAATGTCTTTGG + Intergenic
1057737552 9:97678513-97678535 CTGTTTTTCTCCAGTGGCTTTGG - Intronic
1058736498 9:107899131-107899153 TTTTTTTCCTGGAGTGACTTTGG - Intergenic
1060373094 9:123093087-123093109 TTTTTTTACTTTAGGGACTTAGG + Intronic
1203520606 Un_GL000213v1:42109-42131 TTTTTTTTCTCCACGGCCTGAGG + Intergenic
1186109594 X:6241808-6241830 TTTTTTTTTTAGAGAGGGTTGGG - Intergenic
1186208932 X:7229876-7229898 TTTTTTTTGTCGGGGGGCGGGGG + Intronic
1186888884 X:13940568-13940590 TTTTTTTTCTTAAGGGTTTTAGG - Intergenic
1187432536 X:19238189-19238211 TTTCTTTTCTCAAGTGGCCTGGG - Intergenic
1188795653 X:34461207-34461229 TATTTTTTCTTCTGGGGCTTAGG - Intergenic
1189726003 X:43968949-43968971 TTTTCTTTTTCTGGGGGCTTTGG - Intronic
1191615539 X:63166432-63166454 TTTTTTTTCTTCTGTGGCTTAGG - Intergenic
1191620759 X:63212491-63212513 TTTTTTTTCTTCTGTGGCTTAGG + Intergenic
1193730499 X:85096851-85096873 TTTTTTTTTTTGAGGGGGCTGGG - Intronic
1194285875 X:92009666-92009688 TGTTTTTTATCAAGGGGCCTGGG - Intronic
1194967103 X:100300899-100300921 TTTTTTTTGGCCAGGGGTTTTGG - Intronic
1195709750 X:107764645-107764667 TTTTTTTTCCAGAGAGACTTGGG + Intronic
1196351311 X:114733721-114733743 TTTCTTTACTGGAGGGCCTTTGG - Intronic
1196514066 X:116548977-116548999 GTTTTTTTCTCTAGGGGGTTAGG - Intergenic
1196792350 X:119475599-119475621 TTTTTTTTTTTGCGGGGGTTGGG + Intergenic
1197226435 X:123960590-123960612 TTTTTTTTTTGGTGGCGCTTCGG - Exonic
1197339048 X:125243646-125243668 TTTTTTTTTTGGAAGGGTTTGGG - Intergenic
1198754727 X:139970963-139970985 TTTTTTTTCTCCAGGGGTAGAGG + Intergenic
1199910384 X:152280515-152280537 TTTTTTTTCTCCATGGTGTTTGG + Intronic
1200603431 Y:5234203-5234225 TGTTTTTTATCAAGGGGCCTGGG - Intronic
1202015917 Y:20406448-20406470 TTTTTTTTCTTCAGGGTCTGAGG + Intergenic
1202032153 Y:20587861-20587883 ATTTTTTTCTAGAGGGTATTGGG + Intronic