ID: 1072631939

View in Genome Browser
Species Human (GRCh38)
Location 10:97152250-97152272
Sequence TTTTGTTTTTTTTTCTCGAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 13835
Summary {0: 1, 1: 0, 2: 102, 3: 2793, 4: 10939}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1072631939_1072631946 -7 Left 1072631939 10:97152250-97152272 CCCCTCGAGAAAAAAAAACAAAA 0: 1
1: 0
2: 102
3: 2793
4: 10939
Right 1072631946 10:97152266-97152288 AACAAAACCCTGTTGGGGGAAGG No data
1072631939_1072631950 10 Left 1072631939 10:97152250-97152272 CCCCTCGAGAAAAAAAAACAAAA 0: 1
1: 0
2: 102
3: 2793
4: 10939
Right 1072631950 10:97152283-97152305 GGAAGGTCCCTGCAAATTGAGGG No data
1072631939_1072631952 15 Left 1072631939 10:97152250-97152272 CCCCTCGAGAAAAAAAAACAAAA 0: 1
1: 0
2: 102
3: 2793
4: 10939
Right 1072631952 10:97152288-97152310 GTCCCTGCAAATTGAGGGGATGG No data
1072631939_1072631951 11 Left 1072631939 10:97152250-97152272 CCCCTCGAGAAAAAAAAACAAAA 0: 1
1: 0
2: 102
3: 2793
4: 10939
Right 1072631951 10:97152284-97152306 GAAGGTCCCTGCAAATTGAGGGG No data
1072631939_1072631949 9 Left 1072631939 10:97152250-97152272 CCCCTCGAGAAAAAAAAACAAAA 0: 1
1: 0
2: 102
3: 2793
4: 10939
Right 1072631949 10:97152282-97152304 GGGAAGGTCCCTGCAAATTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1072631939 Original CRISPR TTTTGTTTTTTTTTCTCGAG GGG (reversed) Intronic
Too many off-targets to display for this crispr