ID: 1072631940

View in Genome Browser
Species Human (GRCh38)
Location 10:97152251-97152273
Sequence GTTTTGTTTTTTTTTCTCGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 15127
Summary {0: 1, 1: 1, 2: 47, 3: 849, 4: 14229}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1072631940_1072631946 -8 Left 1072631940 10:97152251-97152273 CCCTCGAGAAAAAAAAACAAAAC 0: 1
1: 1
2: 47
3: 849
4: 14229
Right 1072631946 10:97152266-97152288 AACAAAACCCTGTTGGGGGAAGG No data
1072631940_1072631950 9 Left 1072631940 10:97152251-97152273 CCCTCGAGAAAAAAAAACAAAAC 0: 1
1: 1
2: 47
3: 849
4: 14229
Right 1072631950 10:97152283-97152305 GGAAGGTCCCTGCAAATTGAGGG No data
1072631940_1072631952 14 Left 1072631940 10:97152251-97152273 CCCTCGAGAAAAAAAAACAAAAC 0: 1
1: 1
2: 47
3: 849
4: 14229
Right 1072631952 10:97152288-97152310 GTCCCTGCAAATTGAGGGGATGG No data
1072631940_1072631949 8 Left 1072631940 10:97152251-97152273 CCCTCGAGAAAAAAAAACAAAAC 0: 1
1: 1
2: 47
3: 849
4: 14229
Right 1072631949 10:97152282-97152304 GGGAAGGTCCCTGCAAATTGAGG No data
1072631940_1072631951 10 Left 1072631940 10:97152251-97152273 CCCTCGAGAAAAAAAAACAAAAC 0: 1
1: 1
2: 47
3: 849
4: 14229
Right 1072631951 10:97152284-97152306 GAAGGTCCCTGCAAATTGAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1072631940 Original CRISPR GTTTTGTTTTTTTTTCTCGA GGG (reversed) Intronic
Too many off-targets to display for this crispr