ID: 1072631941

View in Genome Browser
Species Human (GRCh38)
Location 10:97152252-97152274
Sequence GGTTTTGTTTTTTTTTCTCG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 3967
Summary {0: 1, 1: 0, 2: 22, 3: 343, 4: 3601}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1072631941_1072631951 9 Left 1072631941 10:97152252-97152274 CCTCGAGAAAAAAAAACAAAACC 0: 1
1: 0
2: 22
3: 343
4: 3601
Right 1072631951 10:97152284-97152306 GAAGGTCCCTGCAAATTGAGGGG No data
1072631941_1072631950 8 Left 1072631941 10:97152252-97152274 CCTCGAGAAAAAAAAACAAAACC 0: 1
1: 0
2: 22
3: 343
4: 3601
Right 1072631950 10:97152283-97152305 GGAAGGTCCCTGCAAATTGAGGG No data
1072631941_1072631952 13 Left 1072631941 10:97152252-97152274 CCTCGAGAAAAAAAAACAAAACC 0: 1
1: 0
2: 22
3: 343
4: 3601
Right 1072631952 10:97152288-97152310 GTCCCTGCAAATTGAGGGGATGG No data
1072631941_1072631955 30 Left 1072631941 10:97152252-97152274 CCTCGAGAAAAAAAAACAAAACC 0: 1
1: 0
2: 22
3: 343
4: 3601
Right 1072631955 10:97152305-97152327 GGATGGTTGTGAGTTAAGAGTGG No data
1072631941_1072631949 7 Left 1072631941 10:97152252-97152274 CCTCGAGAAAAAAAAACAAAACC 0: 1
1: 0
2: 22
3: 343
4: 3601
Right 1072631949 10:97152282-97152304 GGGAAGGTCCCTGCAAATTGAGG No data
1072631941_1072631946 -9 Left 1072631941 10:97152252-97152274 CCTCGAGAAAAAAAAACAAAACC 0: 1
1: 0
2: 22
3: 343
4: 3601
Right 1072631946 10:97152266-97152288 AACAAAACCCTGTTGGGGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1072631941 Original CRISPR GGTTTTGTTTTTTTTTCTCG AGG (reversed) Intronic
Too many off-targets to display for this crispr