ID: 1072631949

View in Genome Browser
Species Human (GRCh38)
Location 10:97152282-97152304
Sequence GGGAAGGTCCCTGCAAATTG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1072631941_1072631949 7 Left 1072631941 10:97152252-97152274 CCTCGAGAAAAAAAAACAAAACC 0: 1
1: 0
2: 22
3: 343
4: 3601
Right 1072631949 10:97152282-97152304 GGGAAGGTCCCTGCAAATTGAGG No data
1072631938_1072631949 15 Left 1072631938 10:97152244-97152266 CCTAAGCCCCTCGAGAAAAAAAA 0: 1
1: 0
2: 1
3: 22
4: 340
Right 1072631949 10:97152282-97152304 GGGAAGGTCCCTGCAAATTGAGG No data
1072631939_1072631949 9 Left 1072631939 10:97152250-97152272 CCCCTCGAGAAAAAAAAACAAAA 0: 1
1: 0
2: 102
3: 2793
4: 10939
Right 1072631949 10:97152282-97152304 GGGAAGGTCCCTGCAAATTGAGG No data
1072631940_1072631949 8 Left 1072631940 10:97152251-97152273 CCCTCGAGAAAAAAAAACAAAAC 0: 1
1: 1
2: 47
3: 849
4: 14229
Right 1072631949 10:97152282-97152304 GGGAAGGTCCCTGCAAATTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1072631949 Original CRISPR GGGAAGGTCCCTGCAAATTG AGG Intronic
No off target data available for this crispr