ID: 1072633040

View in Genome Browser
Species Human (GRCh38)
Location 10:97159902-97159924
Sequence CAAAGTCAGCAAACCTATCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 162
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 154}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1072633040_1072633044 24 Left 1072633040 10:97159902-97159924 CCAAGATAGGTTTGCTGACTTTG 0: 1
1: 0
2: 0
3: 7
4: 154
Right 1072633044 10:97159949-97159971 GAGAGAATAGGGGTACCAAGAGG No data
1072633040_1072633041 12 Left 1072633040 10:97159902-97159924 CCAAGATAGGTTTGCTGACTTTG 0: 1
1: 0
2: 0
3: 7
4: 154
Right 1072633041 10:97159937-97159959 TCTTTGAAAGATGAGAGAATAGG No data
1072633040_1072633043 14 Left 1072633040 10:97159902-97159924 CCAAGATAGGTTTGCTGACTTTG 0: 1
1: 0
2: 0
3: 7
4: 154
Right 1072633043 10:97159939-97159961 TTTGAAAGATGAGAGAATAGGGG No data
1072633040_1072633042 13 Left 1072633040 10:97159902-97159924 CCAAGATAGGTTTGCTGACTTTG 0: 1
1: 0
2: 0
3: 7
4: 154
Right 1072633042 10:97159938-97159960 CTTTGAAAGATGAGAGAATAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1072633040 Original CRISPR CAAAGTCAGCAAACCTATCT TGG (reversed) Intronic
906819518 1:48914482-48914504 AAAAGTCAGCAAACCTAGAGGGG + Intronic
906833072 1:49054474-49054496 TTAAATCAGCAAACCTATTTTGG + Intronic
907211407 1:52826251-52826273 AAAAGTTTGCAAACCTCTCTGGG - Exonic
907589801 1:55655388-55655410 CAACCTCAGCAAACCTCTCCCGG - Intergenic
907805077 1:57810679-57810701 CAAAGTGAGGTAACATATCTTGG - Intronic
909219820 1:72942716-72942738 AAAATTCTGCAAACCTATTTGGG - Intergenic
915668440 1:157466252-157466274 CATAGTTAGAAAACGTATCTGGG + Intergenic
916157845 1:161874145-161874167 CAAAGTCAGAACACTGATCTTGG + Intronic
918103698 1:181398485-181398507 GCAAGTCAGCCAACCTCTCTGGG - Intergenic
920838297 1:209532596-209532618 CAAAGACAGCATACTTACCTGGG + Intergenic
924255399 1:242177859-242177881 CAAGGTCTACAAACCCATCTGGG + Intronic
1062892414 10:1074180-1074202 CAAATTAGGAAAACCTATCTTGG - Intronic
1064525785 10:16255200-16255222 CAACGTCAGCGTACCCATCTTGG + Intergenic
1067804177 10:49381825-49381847 CAAAGATAGCAAACATCTCTGGG - Intronic
1070454607 10:76600203-76600225 AAAAGTCACCAAACCTATCATGG - Intergenic
1070690936 10:78524915-78524937 CAAAGTCATCAAACCTCCCCTGG - Intergenic
1070694832 10:78554514-78554536 CCAAGTCACTAAACCTCTCTGGG - Intergenic
1071019710 10:81037964-81037986 CAAATTCAGCAAAGATATATAGG + Intergenic
1072213340 10:93267091-93267113 CTAAGTCACCAAGACTATCTAGG - Intergenic
1072633040 10:97159902-97159924 CAAAGTCAGCAAACCTATCTTGG - Intronic
1073496281 10:103893981-103894003 CACAGGCAGAAAACCTCTCTGGG + Intronic
1073978551 10:109127759-109127781 AAATGTCAGAAAATCTATCTAGG + Intergenic
1075066050 10:119289559-119289581 CCAAGTCACCAACCCTCTCTGGG - Intronic
1075217345 10:120547828-120547850 CAAAGTCACAAAAGCTATTTTGG - Intronic
1078970199 11:16401236-16401258 CAGAATCTGCAAACCTTTCTTGG - Intronic
1085576563 11:77610146-77610168 CCAGGGCAGCAAACCCATCTAGG - Exonic
1087969224 11:104458765-104458787 CAAAGTCAGGGAACCAACCTAGG + Intergenic
1090110173 11:123899075-123899097 CAAAGTTAGCACACCTTGCTAGG - Intergenic
1092967196 12:13655636-13655658 GAAAGTCACTAAACCTCTCTGGG + Intronic
1094153652 12:27314103-27314125 CAAACTCAGGAAAGCTAGCTGGG + Intronic
1095809707 12:46359150-46359172 CAAAGTCAGCAACTCTTTCCAGG + Exonic
1098411116 12:70184562-70184584 GAAAGTCACCAAATCTATCTGGG + Intergenic
1098503524 12:71222612-71222634 AAAAGTCTGCAAACATATTTTGG - Intronic
1098584444 12:72139457-72139479 GAAAGTCAGAAAACCTCCCTAGG + Intronic
1099208542 12:79756916-79756938 CAGAGGCAGGAAACCTCTCTTGG + Intergenic
1100340659 12:93676727-93676749 CACAATCAGCAATCTTATCTAGG + Intergenic
1103756593 12:123212336-123212358 AAAAGTCCTAAAACCTATCTGGG + Intronic
1106011307 13:25826298-25826320 GAAAGTCAGCAAGTTTATCTTGG + Intronic
1106778487 13:33031961-33031983 GAAAGTCAGCTAAACTCTCTGGG - Intronic
1111213076 13:85106043-85106065 CAAAAACAGCAAACCTCTGTAGG - Intergenic
1112642213 13:101288665-101288687 CAAAGACAGCAATCATTTCTGGG - Intronic
1116096121 14:40371286-40371308 CAGAGTCAGCTTGCCTATCTTGG + Intergenic
1116603246 14:46955505-46955527 CAAAGTAAGCAAAGGTATTTTGG - Intronic
1119083236 14:71716679-71716701 CAAAGTCAGCAAATAGATGTAGG + Intronic
1129338291 15:74867447-74867469 TAAAGGCAGGAATCCTATCTGGG + Intronic
1130833675 15:87628746-87628768 GAAAGCCAGCACAACTATCTAGG + Intergenic
1137331564 16:47503215-47503237 CAAAGGCTGTTAACCTATCTAGG - Intronic
1137908443 16:52350885-52350907 AAGAGCCAACAAACCTATCTGGG + Intergenic
1140576925 16:76181537-76181559 AAAAGTAAGCAAACCAATATAGG - Intergenic
1145275584 17:21427441-21427463 CTAAGTCAGCTGACCTATGTTGG + Intergenic
1145313433 17:21713350-21713372 CTAAGTCAGCTGACCTATGTTGG + Intergenic
1145711883 17:26985327-26985349 CTAAGTCAGCTGACCTATGTTGG + Intergenic
1146915923 17:36678359-36678381 AAAATTCACCAAACCTCTCTAGG + Intergenic
1147972986 17:44229782-44229804 CAAAGCCAGCCATCCTGTCTTGG + Intergenic
1150012420 17:61517389-61517411 CGAAGTCAGCAGACCTGTGTTGG - Intergenic
1150131134 17:62669919-62669941 AAACGTCAGCAACCCGATCTAGG + Intronic
1150636795 17:66918746-66918768 CAAAGTCTTCAAAACTATCTTGG - Intergenic
1156035611 18:32764109-32764131 CATATTCAGCAAACTAATCTAGG - Intronic
1157138356 18:45081200-45081222 CAAAATTAGAAAAACTATCTTGG - Intergenic
1157551452 18:48584603-48584625 GCAAGTCACCAAACCTCTCTGGG - Intronic
1158406149 18:57161395-57161417 CACAGTCAGGATACCTGTCTTGG + Intergenic
1159204943 18:65237166-65237188 CATAGACTGCAGACCTATCTGGG + Intergenic
1161329644 19:3680228-3680250 CAAAATCAGCAAGCATCTCTTGG + Intronic
1168449798 19:56457468-56457490 GCAAGTCAACAAACCTCTCTGGG + Intronic
929471529 2:42198773-42198795 CATGGTCATCAAACCCATCTTGG - Intronic
929475370 2:42241783-42241805 CAAGGTCACCAAACTAATCTAGG - Intronic
930279030 2:49348084-49348106 CAAAGTCATTGAATCTATCTAGG + Intergenic
931685453 2:64788438-64788460 CAAAGACATGAAACCAATCTAGG - Intergenic
933106415 2:78332337-78332359 AAAAGTCTGCAAATCTAGCTTGG + Intergenic
935084613 2:99832704-99832726 CCAAGTCAACTAACTTATCTTGG + Intronic
937926127 2:127168818-127168840 CAAGGTTAGAAAACCTTTCTGGG + Intergenic
941562806 2:167069753-167069775 AAAAGCCAGCTAACCTCTCTAGG + Intronic
943139191 2:183957814-183957836 CAAAGTCAGCAAAATTATTTTGG - Intergenic
1168752306 20:291457-291479 CAGAGTAGGCAAACCTCTCTAGG - Intergenic
1170119565 20:12896752-12896774 CAGTGCCAGCAAACCTATCACGG + Intergenic
1172866826 20:38106482-38106504 CCAAGTCAGCAAACTTCCCTTGG + Intronic
1174959553 20:55139629-55139651 CATAGCCAGCAAAACTCTCTGGG + Intergenic
1177115128 21:17075848-17075870 TTGAGTCAGCAAATCTATCTAGG + Intergenic
1177977021 21:27863958-27863980 CAAACCAAGCAAACCTTTCTAGG - Intergenic
1183786783 22:40033795-40033817 GCAAGTCAGCCAACCTCTCTGGG - Exonic
954981950 3:54754328-54754350 GCAAGTTACCAAACCTATCTGGG + Intronic
955155341 3:56411716-56411738 AAAAGTCACCAAACCCTTCTGGG - Intronic
957511248 3:81190873-81190895 CAAAATCAACAAATCTAACTGGG + Intergenic
957739912 3:84251417-84251439 AAAAATCAGCAAAACTATCTGGG - Intergenic
958507131 3:94994065-94994087 CAAAATCAGTAAACATATTTTGG + Intergenic
960200143 3:114823954-114823976 CAAAACCAGCAAACATATTTAGG + Intronic
962220212 3:133558619-133558641 ACAAGTTAGGAAACCTATCTTGG + Intergenic
965471690 3:169100920-169100942 CAAGGTCTGCAAACCTAACACGG - Exonic
966674373 3:182569362-182569384 CAAAGTCAGAACAGATATCTTGG - Intergenic
971511194 4:27426450-27426472 TAAGGTCAGCAAACCCAGCTTGG + Intergenic
971804201 4:31334291-31334313 CAAAGTCAACAATCCATTCTTGG - Intergenic
977960365 4:103077834-103077856 CCAAGTCACCCAATCTATCTTGG - Intronic
981776428 4:148373435-148373457 TCAAGTCAGCAAACCTTTGTTGG - Intronic
983568144 4:169175958-169175980 CAAAGGCAGCAATCCCATCATGG - Intronic
984960321 4:185091167-185091189 TAAAGTTATCAAGCCTATCTAGG + Intergenic
985859932 5:2462667-2462689 AAAAGTCAGTAAAACTATCGAGG - Intergenic
986207603 5:5640106-5640128 CAAAGACATGAAACCTATGTTGG - Intergenic
986608141 5:9544043-9544065 CAAATTCAGCAATCCTAATTAGG + Intronic
987122105 5:14777307-14777329 CAAAAACACCAAACATATCTGGG + Intronic
988525270 5:31981815-31981837 CAAAGTCAGGAAACCAGGCTGGG - Intronic
993143720 5:84067929-84067951 CAAAATGAGAAAACCTAACTTGG - Intronic
995659870 5:114469483-114469505 CAAAGTCAGAAAATGTATCCTGG - Intronic
995978893 5:118077662-118077684 TAAGGTCAGCAATCATATCTTGG + Intergenic
998098165 5:139409408-139409430 CAAAGTCAGCAACCCAAGCCAGG - Intronic
1001021024 5:168182735-168182757 CAGAGTCAGCAATGCTAACTGGG + Intronic
1001059044 5:168472607-168472629 AAAAGACAGCAAACCTCACTGGG + Intergenic
1005238926 6:23800620-23800642 GAAAGTCAGTAAAGTTATCTAGG - Intergenic
1005285942 6:24326952-24326974 CAAAGTGAGCCCATCTATCTGGG - Intronic
1012432330 6:99177339-99177361 CCAAGTCACCTAATCTATCTTGG + Intergenic
1012824467 6:104129456-104129478 CAAGCTCAGCAAACCTACATAGG - Intergenic
1012955628 6:105566725-105566747 CAACCTCAGCTAATCTATCTGGG + Intergenic
1012995498 6:105968664-105968686 CAAAGTCAGTAAAATTAGCTGGG + Intergenic
1018402846 6:163443177-163443199 AAAATTCAGCAAAAATATCTTGG - Intronic
1018651079 6:165991602-165991624 CAAGGCCTGCAAACCCATCTTGG - Intergenic
1020026298 7:4902426-4902448 GAAAATCACCAAACCTCTCTGGG + Intergenic
1024351299 7:48367626-48367648 CAAAATCAGCACACCAATCATGG + Intronic
1024988164 7:55213681-55213703 AAAAGTCATCATACCTGTCTGGG + Intronic
1027202171 7:76071118-76071140 CACAGCCAGCAAACATACCTTGG + Intergenic
1028921296 7:96313343-96313365 CAAAGACAGGAAACCAACCTAGG + Intronic
1029848805 7:103441795-103441817 CAAAGTCAGCAAAGCATTGTGGG + Intronic
1031018189 7:116598033-116598055 CTAAGTTAGAAAACCTATCAGGG - Intergenic
1032874072 7:136018687-136018709 GCAAGTCATCAAACCTCTCTGGG + Intergenic
1033727390 7:144133251-144133273 CAAATTCAGTTACCCTATCTAGG - Intergenic
1034070986 7:148184789-148184811 CAAAGTGAACAATCCTAACTAGG + Intronic
1034297342 7:149986043-149986065 CAAAGTCAGAAAACCTTCCAGGG - Intergenic
1034808682 7:154110811-154110833 CAAAGTCAGAAAACCTTCCAGGG + Intronic
1035158264 7:156931976-156931998 CAAAATAAGCAAATGTATCTTGG + Intergenic
1037245864 8:16834265-16834287 TAAAGTCAGAAAACCCAACTTGG + Intergenic
1037611013 8:20476382-20476404 TAAGGTCAGAAAACCTCTCTGGG - Intergenic
1038235385 8:25748092-25748114 CAAACTCAGCAACTCAATCTAGG - Intergenic
1038386975 8:27157469-27157491 CAATGTCAGAAAACCTAACATGG + Intergenic
1038873665 8:31523574-31523596 CCAAGTCAGAAAACCTAGTTGGG + Intergenic
1039193426 8:35002946-35002968 CACAGTCACCAAACCCATCTAGG - Intergenic
1039618749 8:38977478-38977500 CTGAGTCAGCACATCTATCTGGG - Intronic
1041595940 8:59653109-59653131 AAAATTCAGCAAACTAATCTTGG - Intergenic
1042183641 8:66115609-66115631 CAGAGTCAGCAACCCAAGCTGGG + Intergenic
1042992004 8:74651909-74651931 GAAAGGTAGCAAGCCTATCTAGG + Intronic
1043054285 8:75418196-75418218 CACAGACAGCACACCAATCTAGG - Intronic
1043242943 8:77959199-77959221 ACAAGTCAGTTAACCTATCTGGG + Intergenic
1046579610 8:116076132-116076154 CAAAGTCAGCAAGTGTATCAAGG + Intergenic
1049802739 8:144525750-144525772 CAAAGACAGGACACCTTTCTGGG - Exonic
1052793023 9:32894864-32894886 CAAAGACATGAAACCAATCTAGG + Intergenic
1053484337 9:38440734-38440756 GACAGTCAGCAAACTTATGTGGG + Intergenic
1055035753 9:71816501-71816523 GGAAGTCAGCGAACCTATTTGGG - Intronic
1055585409 9:77754182-77754204 AAAAGGCACCAAACCTGTCTTGG - Intronic
1055632665 9:78239257-78239279 CAACGGCAGCAAAACTAGCTAGG - Intronic
1056272977 9:84965273-84965295 CTATGTCTGCAAAACTATCTTGG - Intronic
1057878957 9:98778726-98778748 GCAAGTCAGCAATCCTGTCTGGG - Intronic
1058741460 9:107946866-107946888 GAAAGTCACTAATCCTATCTGGG - Intergenic
1058887376 9:109331552-109331574 GAAAGTCTGCAAACCGGTCTGGG + Intergenic
1058895543 9:109397637-109397659 TCAATTCAGCAAACCTTTCTGGG - Intronic
1060445657 9:123685007-123685029 CAAAGTCAGGAGACCCACCTGGG + Intronic
1186413028 X:9360419-9360441 CAAACTCAGCCAACCTACCCAGG + Intergenic
1187371152 X:18707263-18707285 CAAAGTAATTCAACCTATCTAGG - Intronic
1187850399 X:23586111-23586133 CAAACTCAGCAAAGTTTTCTAGG + Intergenic
1188377844 X:29454689-29454711 AAAAATCAGCAAAGCTATATGGG + Intronic
1190543687 X:51503299-51503321 CATGGTCAGGAAACCTTTCTTGG - Intergenic
1192014482 X:67314868-67314890 AAAAGTCAGAAAACATATTTGGG - Intergenic
1193514220 X:82444288-82444310 AAAAGTTAGCAAACATATATTGG + Intergenic
1194900475 X:99503359-99503381 CATAGACAACAAACTTATCTTGG + Intergenic
1195538051 X:106031399-106031421 AAAAGACAGAAAACTTATCTGGG - Intergenic
1197366415 X:125568937-125568959 TAAAGTCAGCATACCTATATTGG - Intergenic