ID: 1072633819

View in Genome Browser
Species Human (GRCh38)
Location 10:97164757-97164779
Sequence TGCCACGGCAGTCCTGGGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 266
Summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 247}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1072633819_1072633831 -4 Left 1072633819 10:97164757-97164779 CCCTGCCCAGGACTGCCGTGGCA 0: 1
1: 0
2: 1
3: 17
4: 247
Right 1072633831 10:97164776-97164798 GGCATTGCCAGGGGTGGGGTGGG 0: 1
1: 0
2: 6
3: 69
4: 655
1072633819_1072633832 -1 Left 1072633819 10:97164757-97164779 CCCTGCCCAGGACTGCCGTGGCA 0: 1
1: 0
2: 1
3: 17
4: 247
Right 1072633832 10:97164779-97164801 ATTGCCAGGGGTGGGGTGGGAGG 0: 1
1: 0
2: 14
3: 144
4: 1239
1072633819_1072633829 -8 Left 1072633819 10:97164757-97164779 CCCTGCCCAGGACTGCCGTGGCA 0: 1
1: 0
2: 1
3: 17
4: 247
Right 1072633829 10:97164772-97164794 CCGTGGCATTGCCAGGGGTGGGG 0: 1
1: 0
2: 1
3: 14
4: 222
1072633819_1072633827 -9 Left 1072633819 10:97164757-97164779 CCCTGCCCAGGACTGCCGTGGCA 0: 1
1: 0
2: 1
3: 17
4: 247
Right 1072633827 10:97164771-97164793 GCCGTGGCATTGCCAGGGGTGGG 0: 1
1: 0
2: 3
3: 15
4: 159
1072633819_1072633830 -5 Left 1072633819 10:97164757-97164779 CCCTGCCCAGGACTGCCGTGGCA 0: 1
1: 0
2: 1
3: 17
4: 247
Right 1072633830 10:97164775-97164797 TGGCATTGCCAGGGGTGGGGTGG 0: 1
1: 0
2: 6
3: 53
4: 540
1072633819_1072633826 -10 Left 1072633819 10:97164757-97164779 CCCTGCCCAGGACTGCCGTGGCA 0: 1
1: 0
2: 1
3: 17
4: 247
Right 1072633826 10:97164770-97164792 TGCCGTGGCATTGCCAGGGGTGG 0: 1
1: 0
2: 2
3: 10
4: 172
1072633819_1072633833 0 Left 1072633819 10:97164757-97164779 CCCTGCCCAGGACTGCCGTGGCA 0: 1
1: 0
2: 1
3: 17
4: 247
Right 1072633833 10:97164780-97164802 TTGCCAGGGGTGGGGTGGGAGGG 0: 1
1: 2
2: 16
3: 187
4: 1618

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1072633819 Original CRISPR TGCCACGGCAGTCCTGGGCA GGG (reversed) Intronic
900206857 1:1435337-1435359 AGTCACGGCAGTGGTGGGCATGG + Intronic
900594910 1:3476310-3476332 TGCCGGTGCAGTCCTGGGGATGG - Intronic
901142159 1:7042271-7042293 TGCCAGGGCAGCCCAGGGAAGGG - Intronic
901776870 1:11566108-11566130 TGTTACGGCAGCCCTGGGAAAGG + Intergenic
902122270 1:14176437-14176459 TGCCACAGCTGCCCAGGGCAGGG + Intergenic
902253536 1:15171963-15171985 TGACTCGGCAGGCCTGGGCTGGG - Intronic
902361213 1:15943561-15943583 TGCCCTCCCAGTCCTGGGCATGG + Intronic
904270902 1:29349472-29349494 TGCCAGGCCTGTCCTGGGCTTGG + Intergenic
904319558 1:29688039-29688061 AGGCAGGGCAGCCCTGGGCATGG + Intergenic
904541838 1:31238858-31238880 TGACCGGGCAGTCCTGGGAAAGG - Intronic
905360136 1:37413377-37413399 TGCCAGAGGACTCCTGGGCAGGG + Intergenic
905361873 1:37426361-37426383 TGTCATGGCAGTACTGTGCATGG + Intergenic
907266775 1:53266538-53266560 TGCCACGACATTCTTGAGCATGG + Exonic
912680362 1:111725402-111725424 TCCCAGGGCAGTCCTGGGGGGGG + Exonic
913219657 1:116649198-116649220 TGCCACAGCAGCCTTGGGCTAGG - Intronic
914241670 1:145857041-145857063 TGGCAGGGCAGGCCTGTGCAAGG - Intronic
915283158 1:154836489-154836511 TGCCAGGGCAGAGCTGAGCAGGG + Intronic
915299861 1:154945784-154945806 TGGCACGGCTGCCCTGGGCTGGG - Exonic
915564360 1:156705631-156705653 GGCCACTTCAATCCTGGGCAGGG - Intronic
915835219 1:159171276-159171298 AGCCACTGCAGGCCTGGGCAAGG - Intergenic
917438398 1:175044203-175044225 TGAGACGGCGATCCTGGGCAGGG - Intergenic
917494944 1:175531876-175531898 TGCCTAGGCAGTCAGGGGCAGGG - Intronic
917501670 1:175591345-175591367 TCCCACAGCAGTCCTGGGAGGGG - Intronic
919465002 1:197916011-197916033 AGGCACCGCAGTCCTGGGAAAGG + Intronic
920245547 1:204585045-204585067 AGACACTGCAGTCCTGGGGAGGG + Intergenic
920309877 1:205042882-205042904 TGCCCCTTCAGCCCTGGGCAGGG + Intergenic
921492752 1:215798976-215798998 TGCCACAGCACTTCTGGCCATGG + Exonic
922881955 1:228987831-228987853 TTCCAGGGCAGTCTTGAGCAGGG + Intergenic
922891109 1:229062513-229062535 TTCCACGGGAGTTCTGGGCTTGG - Intergenic
1064869290 10:19920166-19920188 TGATACGGCAGTGCTGGGAAGGG + Intronic
1066406979 10:35127344-35127366 TGCCCCGCCAGTCCTTGGCCCGG - Intronic
1067115678 10:43433908-43433930 TGCCACTGCACTCCTGGCTAGGG + Intergenic
1067850834 10:49752608-49752630 TGCCATGGCCGTCCTGAGGAAGG + Intronic
1069840761 10:71338010-71338032 AGCCACTGCTGGCCTGGGCAGGG - Intronic
1072001973 10:91205344-91205366 TGCCACGTCTGACCTGGGGAAGG - Intronic
1072633819 10:97164757-97164779 TGCCACGGCAGTCCTGGGCAGGG - Intronic
1073539328 10:104305668-104305690 TGCAAGGGGATTCCTGGGCATGG - Intergenic
1074165024 10:110867509-110867531 TACCATGGGAGTCCTGGGAATGG - Intergenic
1074801679 10:117006020-117006042 TGCCACTTCTCTCCTGGGCATGG - Intronic
1076160765 10:128242820-128242842 TCCCAAGGCAGGCCTGTGCAAGG - Intergenic
1076199202 10:128545026-128545048 TGCCAGGGCTGTCCTGTGTATGG + Intergenic
1076769657 10:132656106-132656128 GGTCAGGACAGTCCTGGGCATGG - Intronic
1076890485 10:133280879-133280901 GGCCAGGGCGGTGCTGGGCAGGG + Intronic
1076890521 10:133281003-133281025 AGCCAGGGCGGTGCTGGGCAGGG + Intronic
1076890543 10:133281073-133281095 GGCCAGGGCAGTGCTGGGCAGGG + Intronic
1076890578 10:133281197-133281219 AGCCAGGGCGGTGCTGGGCAGGG + Intronic
1077224700 11:1434928-1434950 TGGCCGGGCTGTCCTGGGCAGGG + Intronic
1077242753 11:1519320-1519342 TCCCAGGGCAGTCCTGGGGCAGG - Intergenic
1077467888 11:2742270-2742292 GGGCAGGGCAGTCCAGGGCAGGG + Intronic
1080457480 11:32429761-32429783 ACCCAGGGCAGTCCTGGGCCAGG - Intronic
1080605982 11:33865098-33865120 TGCCCAGGTAGTGCTGGGCATGG - Intronic
1080655056 11:34252216-34252238 TGCCACGGCTTTCCCAGGCATGG - Intronic
1081777788 11:45688021-45688043 TGCCAAGTCAGTCCCTGGCAGGG - Intergenic
1083300696 11:61738302-61738324 TGCCATGGAAGGCCAGGGCAGGG + Intronic
1083303301 11:61749986-61750008 TGCCACGACAGTTCTGGGGTTGG - Intergenic
1083849274 11:65355593-65355615 TGCCAGGGCAGAGCTGGGGAGGG - Intronic
1084705898 11:70815817-70815839 GCCCACTGCAGTCCTGGCCAAGG + Intronic
1085152163 11:74260981-74261003 GGCCACGTGAGGCCTGGGCAGGG - Intronic
1085330234 11:75642809-75642831 TGTCACCGCAGACCTAGGCATGG + Intronic
1085834339 11:79936275-79936297 TGCCATGTGAGTCCTGGGAAAGG - Intergenic
1086967937 11:93049467-93049489 TGCCACGGTCATTCTGGGCATGG - Intergenic
1087333513 11:96813699-96813721 AACCAAGACAGTCCTGGGCAAGG + Intergenic
1088817954 11:113434277-113434299 TGCCAAGGCTGTGCTGGGGAGGG - Intronic
1089150144 11:116357998-116358020 TGCGTCTGCAGTCCTGGGAAGGG - Intergenic
1091600088 12:1912755-1912777 TGACCCGGCAGTGCTGGGCATGG + Intronic
1096466435 12:51849338-51849360 GGCCAAGGCAGTCCTGGGAAAGG - Intergenic
1096486456 12:51985259-51985281 TGCCATAGCAGACCTGGGCCTGG + Exonic
1102474126 12:113177538-113177560 AGCCAGGGTAGTCCTGGGCCAGG + Intronic
1102502895 12:113364825-113364847 TGCCACAGCAGTCCTCTGAAGGG + Intronic
1102575441 12:113853461-113853483 AGGCACGGCAGGCCTGGGGAAGG + Intronic
1103588861 12:121976338-121976360 TGCCTACGCAGCCCTGGGCACGG + Intronic
1103852402 12:123941670-123941692 TGCCCCGGCACGCCTGCGCAGGG + Intronic
1104101811 12:125619653-125619675 TGCCACAGCAGGGCCGGGCATGG - Intronic
1104779035 12:131407969-131407991 TCTCACGTCAGTCCTGAGCACGG + Intergenic
1104895773 12:132162988-132163010 AGCCACCGAAGTCATGGGCAGGG + Intergenic
1104897775 12:132172718-132172740 TTCCCCAGCAGCCCTGGGCAGGG + Intergenic
1106187907 13:27424995-27425017 AGCCACTGCAGTCGTGGCCAGGG + Intronic
1106479013 13:30123066-30123088 TGTGACGGCTGTCCTTGGCAGGG - Intergenic
1106923390 13:34588573-34588595 TGCCCCGCCAGGCGTGGGCAGGG + Intergenic
1113364318 13:109661952-109661974 TGGCACAGCATTACTGGGCAGGG + Intergenic
1113842049 13:113365877-113365899 TTCCACGGCAGTGGTGGGAAAGG - Intergenic
1115859875 14:37672495-37672517 TGCCACAGCACTCCAGGGCTAGG - Intronic
1115935808 14:38551148-38551170 TACAAGGACAGTCCTGGGCAAGG + Intergenic
1119745660 14:77042098-77042120 TGTCACGGCAGCTCTGGCCAAGG + Intergenic
1121199448 14:92105639-92105661 TGCCAAAGCTGTCCTGGGGAAGG + Intronic
1122113302 14:99515936-99515958 AGGCACGGCACTCCTGGGGAGGG + Intronic
1123115384 14:105892067-105892089 CTCCACTGCAGTCCTGGGCCTGG - Intergenic
1123119637 14:105910785-105910807 CTCCACTGCAGTCCTGGGCCTGG - Intergenic
1124050537 15:26193305-26193327 TGCCACAGATGACCTGGGCAAGG + Intergenic
1125577194 15:40764017-40764039 GGCCACGGCGGTCACGGGCAAGG + Exonic
1125743043 15:41980748-41980770 TGGCAAGGAAGTCCTGGGAAGGG + Intergenic
1126019088 15:44382348-44382370 TGCCACTGCACTCCTGGCCTGGG - Intronic
1127922667 15:63505133-63505155 GGCCACGGCAGGGCGGGGCAAGG - Intronic
1128892342 15:71342564-71342586 TGCCAGGGCACACCAGGGCAGGG - Intronic
1131016250 15:89059879-89059901 TTCCACAGCTGGCCTGGGCAGGG - Intergenic
1132355581 15:101169018-101169040 TGACAGGGCAGGCCTGGGCTTGG - Intergenic
1132559568 16:587254-587276 GGCCAAGCCAGGCCTGGGCAGGG - Intergenic
1132626730 16:894933-894955 TGACAGGGCTGTCCTGGGCAGGG + Intronic
1132998628 16:2837874-2837896 TGGCACAGCAGCCCTGGTCAAGG + Intronic
1133103826 16:3494493-3494515 TGTCAAGGCAGGACTGGGCACGG - Intronic
1133645997 16:7765177-7765199 AGCCACGGCAGTGCTGGCCCAGG + Intergenic
1136271579 16:29151955-29151977 TGCCAGGGCCGCACTGGGCAGGG + Intergenic
1136367114 16:29813950-29813972 AGCCACAGCAGGCCTGGGCTAGG - Intronic
1136514374 16:30759144-30759166 TGCCAGGGCAGGGCTGGGCTGGG - Exonic
1137402544 16:48165145-48165167 TCCCACAGCAGTTCTGGGAATGG + Intergenic
1138332738 16:56228016-56228038 TGCCTGGGCAGTGCTGGGCTTGG + Intronic
1138392989 16:56683616-56683638 TGACACAGCAGTTCTGGGGAAGG - Intronic
1140134724 16:72195812-72195834 GGCCAGGGCCGTCCTGGGCTGGG + Intergenic
1141065230 16:80908700-80908722 AGCCACTGCACTCCTGGGCAGGG + Intergenic
1141562202 16:84877032-84877054 TCCCACCTCAGTCCTGGGAAGGG + Intronic
1141573977 16:84952455-84952477 TGCCCGGCCAGTCCTGGGCTTGG + Intergenic
1141691599 16:85599909-85599931 TGTCACCCCAGTCATGGGCAAGG + Intergenic
1142060875 16:88028301-88028323 TGCGAGGGCAGCCGTGGGCAGGG + Intronic
1142075194 16:88113939-88113961 TGCCAGGGCCGCACTGGGCAGGG + Intronic
1142317268 16:89355796-89355818 TGCCACGGCGGTTCACGGCAAGG + Intronic
1142766118 17:2065228-2065250 TGCCTCGGGGGCCCTGGGCAGGG + Intronic
1143783769 17:9242438-9242460 TGCCACAGCCCTTCTGGGCAGGG - Exonic
1143972386 17:10804960-10804982 TGCAGCGGCAGTCCTTGGCAGGG + Intergenic
1144203061 17:12958654-12958676 TGCCACACCCTTCCTGGGCAGGG - Intronic
1149602639 17:57903223-57903245 TGCCACAGCAGTCCCAGGCCAGG + Intronic
1152211612 17:79005381-79005403 TGCAGCGGCAGGCCTGGGGATGG - Intronic
1152218925 17:79050165-79050187 TTCCACGGCAGCCCTAGGAAAGG - Intergenic
1152442358 17:80316678-80316700 TGCCACTACATACCTGGGCAGGG - Intronic
1153304348 18:3618641-3618663 TGACAAGGCAGTTCTGGGCCGGG + Intronic
1154107231 18:11533617-11533639 TTCCACGGGAATCCTGGGTACGG + Intergenic
1155307750 18:24495731-24495753 AGCCCCAGCAGTCCTGGGGAGGG + Intergenic
1159026190 18:63183974-63183996 TGCCACTGTGGTCCTGGGGATGG - Intronic
1160181373 18:76639418-76639440 TGCCACGGTAGTCAAGGGCCAGG + Intergenic
1160508568 18:79440897-79440919 TCCCACGTCTGGCCTGGGCAGGG - Intronic
1160849573 19:1183865-1183887 TGCCACGTGAGTGCAGGGCAAGG + Intronic
1162479692 19:10921162-10921184 CCCCTGGGCAGTCCTGGGCATGG - Intronic
1163282467 19:16325821-16325843 CGCCGCGGCAGCCCTGGGCCTGG + Exonic
1164761544 19:30731961-30731983 TGTCATTTCAGTCCTGGGCAAGG + Intergenic
1165702298 19:37947924-37947946 TGCCACAGAAGTCTTGGCCAGGG - Intronic
1165875460 19:39003430-39003452 TGCCACTGCACTCCTGGGCCTGG + Intronic
1166373438 19:42314603-42314625 TGGCCAGGCAGTCCTGGGGAAGG - Exonic
1166755937 19:45191649-45191671 GGCCACGGCATTCCTGGGCTTGG - Intronic
1166884868 19:45954218-45954240 GCCCACAGCAGCCCTGGGCAGGG + Intronic
1167213048 19:48145584-48145606 TGCCACTGCAGGGCTGTGCATGG + Intronic
926801330 2:16663561-16663583 TCCCAAGCCAGCCCTGGGCAAGG - Intronic
927140494 2:20126996-20127018 TGCCAAGGCAGCCCTGGGAGGGG + Intergenic
927929658 2:27036031-27036053 TGCCACGGCAAACCTAGGCAAGG + Exonic
928283174 2:29966423-29966445 GGCCAGGGCAGAACTGGGCAGGG - Intergenic
930001660 2:46865820-46865842 TGCCAGGGCAGTGCTGAGCCTGG + Intergenic
930105111 2:47633163-47633185 TGCCCAGGCTGCCCTGGGCAAGG - Intergenic
931746288 2:65294348-65294370 TGCCCCGGCAGCCCTGTGAAAGG + Intergenic
932119312 2:69083474-69083496 TGCCACTGGAGTCCAAGGCAGGG - Intronic
937242366 2:120470563-120470585 TGCCAAGACAATCCAGGGCAAGG - Intergenic
937348371 2:121142602-121142624 TGCCACATCAGACCTGGTCAAGG + Intergenic
940315035 2:152319746-152319768 AGCCACAGCAGTACTGGGCTTGG - Intergenic
940567390 2:155384719-155384741 AGGCACAGCAGTCCAGGGCAGGG + Intergenic
942247880 2:174024100-174024122 TGCCCCTGCAGGCCTGGCCACGG + Intergenic
942293929 2:174499533-174499555 GGCCCAGGCAGTCCTGGGCAGGG - Intergenic
946015684 2:216602364-216602386 TCACACTGGAGTCCTGGGCAGGG - Intergenic
946178542 2:217936593-217936615 TGTGACGGCTGTACTGGGCAGGG - Intronic
947839826 2:233200577-233200599 TGCCAGGTCAGGCCTGGGAAGGG - Intronic
1169657275 20:7939172-7939194 TGCCAGGGAAGTCATGGGAAGGG - Intronic
1169788618 20:9386164-9386186 AACCACGGAAGTCCGGGGCAGGG + Intronic
1170875596 20:20247066-20247088 TGCCACGAAGGGCCTGGGCAAGG + Intronic
1171224006 20:23425383-23425405 GGCCACTGCAGACCTGGGCAGGG - Intergenic
1171498401 20:25574313-25574335 TGCCATGGCATGGCTGGGCAAGG + Intronic
1172055801 20:32153420-32153442 TGCCACAGCAGTCCCTGGCCTGG + Intronic
1172062661 20:32197010-32197032 TGGCACGCCCGTGCTGGGCATGG + Exonic
1172508129 20:35479308-35479330 TGCCAGGGCAGTCCAGGAGAAGG + Exonic
1172696305 20:36825539-36825561 TGCCACCGCAGCCCTCGGCCAGG + Intronic
1175778809 20:61669302-61669324 TGCCAAGGCAAGCCTGGGCCAGG + Intronic
1175795470 20:61767761-61767783 GGACACTGCAGCCCTGGGCAGGG + Intronic
1179442845 21:41407679-41407701 AGCCAGGGGAGTCCTGGGCTGGG + Intronic
1180820949 22:18827256-18827278 TGCCACAGCAGCCTTGGGCTAGG - Intergenic
1181192028 22:21148789-21148811 TGCCACAGCAGCCTTGGGCTAGG + Intergenic
1181207169 22:21261721-21261743 TGCCACAGCAGCCTTGGGCTAGG - Intergenic
1181262372 22:21607598-21607620 TGCCATGGCAGACCTGGGTGAGG + Intronic
1181960363 22:26618105-26618127 TGGCTCAGCAGGCCTGGGCAGGG + Intergenic
1183115056 22:35685457-35685479 TCCCACAGAAGTCCTGGGAATGG + Intergenic
1184089224 22:42283671-42283693 GGCCAGGGCAGGGCTGGGCAGGG - Intronic
1184262811 22:43329105-43329127 TGCCAGTGCTGTCCTGGGCCAGG + Intronic
1184728698 22:46361107-46361129 TTCCACGGCCACCCTGGGCATGG + Exonic
1185273440 22:49939024-49939046 TGTGACCTCAGTCCTGGGCAGGG + Intergenic
1185289138 22:50015271-50015293 TCCCTCGGCAGCCCTGGGGAGGG + Exonic
1203219751 22_KI270731v1_random:33695-33717 TGCCACAGCAGCCTTGGGCTAGG + Intergenic
1203271076 22_KI270734v1_random:53132-53154 TGCCACAGCAGCCTTGGGCTAGG - Intergenic
949535553 3:4993438-4993460 TGCCAGCTCAGCCCTGGGCAGGG + Intergenic
950128341 3:10524950-10524972 TGCCACCCCTGTGCTGGGCATGG + Intronic
950448042 3:13049319-13049341 TGGCAGGGCAGCCCTGGGCCTGG - Intronic
951527716 3:23669825-23669847 TGCCATGGTAATACTGGGCATGG - Intergenic
954212128 3:49103816-49103838 TGCCTCCCCAGTCCTGGCCATGG - Intronic
954371559 3:50171784-50171806 CGCCTCTGAAGTCCTGGGCAGGG - Intronic
954377193 3:50201479-50201501 CTCCCCGGCATTCCTGGGCAAGG + Intergenic
961642318 3:128372350-128372372 TGCCATGGCAGTCCAGGGCATGG - Intronic
962404667 3:135090679-135090701 TGGCACTGCAGACATGGGCATGG - Intronic
966428572 3:179807620-179807642 TTCGACCTCAGTCCTGGGCATGG + Intronic
967873597 3:194251645-194251667 TGCCACGTCAGTCCAGCCCAAGG - Intergenic
968716547 4:2164147-2164169 TGTCACTGCAGTCCAGGTCATGG - Intronic
973547329 4:51995090-51995112 AGCCAAGGCTGTCCGGGGCAAGG - Exonic
976367241 4:84245296-84245318 GGCCACGGGAGGCCTGGTCATGG + Intergenic
976769037 4:88631411-88631433 TGCCACTGCACTCCAGGGCCTGG + Intronic
983453888 4:167938911-167938933 CGCCACGGCAGTTCTTGCCAAGG - Intergenic
983843688 4:172488820-172488842 TGCGAAGGCAGTCCTGGGGTGGG + Intronic
983944428 4:173569510-173569532 TGCCAGGGCACTGGTGGGCAAGG + Intergenic
985695722 5:1339048-1339070 TGACCCTGCTGTCCTGGGCATGG - Intronic
986533756 5:8765199-8765221 TGCCTCAGCATTCCAGGGCAGGG - Intergenic
991586572 5:68208153-68208175 TGCCACTGCACTCCAGGGCCAGG - Intergenic
994662096 5:102666416-102666438 CTCCATGGCAGTCCTGAGCACGG + Intergenic
996353507 5:122571958-122571980 TGCCAAGGCAGTGCTGGGGATGG + Intergenic
998024473 5:138803193-138803215 TGCCACTGCACTCCAGCGCATGG - Intronic
1001694509 5:173660175-173660197 AGCCCTGGCAGCCCTGGGCAGGG - Intergenic
1002692308 5:181059070-181059092 TGCCACTTCAGTCCTGGGGAGGG + Intronic
1002789497 6:426947-426969 TGCCAAGGCAGGCCTGGGGTGGG + Intergenic
1004300688 6:14454600-14454622 TGTCACTGCTGTCCTGGCCAGGG - Intergenic
1006417371 6:33912685-33912707 TGACAGGGCAGCCTTGGGCATGG - Intergenic
1007383512 6:41505109-41505131 GGCCAAGGCCGCCCTGGGCAGGG + Intergenic
1009413764 6:63394782-63394804 GCACCCGGCAGTCCTGGGCAGGG - Intergenic
1014964502 6:127730223-127730245 TGCCACTGCAGTCCAGGCCTGGG + Intronic
1018198980 6:161378276-161378298 GGCCACAGCAGTCCTGGGCCAGG + Intronic
1018816626 6:167337296-167337318 TGCCTGGGCAGCCCTGGGAAGGG + Intronic
1019171309 6:170134752-170134774 TCACACAGCAGCCCTGGGCAGGG - Intergenic
1019171332 6:170134822-170134844 TCACACAGCAGCCCTGGGCAGGG - Intergenic
1019490658 7:1311737-1311759 TGCCAAGCAGGTCCTGGGCAGGG - Intergenic
1020082546 7:5294614-5294636 TGACACGTCACTACTGGGCAAGG - Intronic
1020498048 7:8881245-8881267 TGCCACAGCAGTCCTGGAACAGG + Intergenic
1022219746 7:28301433-28301455 TGCCAAGGTAGGCCTGGGCTTGG + Intronic
1024185630 7:46945648-46945670 TGCCCAGACAGTGCTGGGCAGGG - Intergenic
1024284620 7:47746580-47746602 TGCCAGAGCAGTGCTGGGTATGG + Intronic
1024766344 7:52665534-52665556 TGCCACAACAGTCCTAGCCACGG + Intergenic
1024984779 7:55185530-55185552 GGACTCTGCAGTCCTGGGCATGG - Intronic
1026850724 7:73721638-73721660 TGCTTTGGCAGTCCTGGGGAAGG - Intergenic
1028730036 7:94136074-94136096 TGCCAGGCTAGTCCTGGCCATGG + Intergenic
1029715394 7:102322621-102322643 TGCAAGGCCAGTCTTGGGCAAGG - Intergenic
1032280301 7:130494467-130494489 TGCCTTTGAAGTCCTGGGCATGG + Intronic
1034310880 7:150086625-150086647 AGCCAGGGCAATCCTGGGCTGGG + Intergenic
1034795965 7:154014009-154014031 GGCCAGGGCAATCCTGGGCTGGG - Intronic
1035417722 7:158704305-158704327 TGTCCCCTCAGTCCTGGGCATGG - Intronic
1035417741 7:158704386-158704408 TGTCCCCTCAGTCCTGGGCATGG - Intronic
1035456960 7:159014888-159014910 TGCCACGACTGTGGTGGGCACGG + Intergenic
1037605693 8:20435529-20435551 TGCCACGGAAGGCCTGGTGATGG + Intergenic
1037947203 8:22996958-22996980 TCCCGGGGCAGTCCTGGCCAGGG + Intronic
1038299525 8:26330037-26330059 TATCACTGCAGTCCTGGGAAGGG - Intronic
1038470092 8:27808389-27808411 TGTAAAGGTAGTCCTGGGCACGG + Intronic
1039914281 8:41848483-41848505 AGCAACGTCAGTCCTGGGCCTGG - Intronic
1040342020 8:46445912-46445934 TTCCAGGGCTGTCCCGGGCAGGG - Intergenic
1041248995 8:55916740-55916762 TGCCATTGCAGTATTGGGCATGG - Intronic
1042307170 8:67343850-67343872 CGCCGCGGCAGCTCTGGGCAGGG - Intergenic
1043702874 8:83312966-83312988 TGCCAAGGCTGTCCTTGCCAAGG + Intergenic
1048573400 8:135672781-135672803 TGCCAGGGCTGGCCAGGGCATGG - Intergenic
1050472477 9:6007787-6007809 TGCCCCGGCAGGCCTAGGCTGGG + Exonic
1052329837 9:27256249-27256271 AGCCAAGACAATCCTGGGCAAGG + Intergenic
1056604794 9:88077212-88077234 TGACACGGGTGGCCTGGGCAGGG - Intergenic
1056757399 9:89390406-89390428 GGCTACGGAAGGCCTGGGCAGGG + Intronic
1056796577 9:89662820-89662842 GGCCAGGGCAGCCATGGGCAGGG - Intergenic
1057037057 9:91818737-91818759 TGCCCCAGCAGTCCTGGAGATGG + Intronic
1057747871 9:97766263-97766285 TGCCTTGGCATTCCTGGGCTGGG - Intergenic
1059424924 9:114215060-114215082 AGCCTTGGCAGTCCTGGCCAGGG - Intronic
1060104733 9:120866529-120866551 TCCCACAGCAACCCTGGGCAGGG + Intronic
1061499231 9:130992693-130992715 TGGCAGGGGAGTCCTGGGGAAGG + Intergenic
1061616685 9:131784931-131784953 TGGCCCGGCAGCCCTGGGGAAGG + Intergenic
1061856023 9:133442472-133442494 AGCCACGGCAGGCCTGGGTGTGG + Exonic
1061861321 9:133470016-133470038 CCCCAGGGCAGTACTGGGCAGGG - Exonic
1061904150 9:133688084-133688106 TGCCACGCCAGCCTTGGACAGGG - Intronic
1062139536 9:134948247-134948269 TGCCGCGGCTTTCCTGGGGAGGG - Intergenic
1062213895 9:135378734-135378756 TGCCACGTCAGACCTGGGCTGGG - Intergenic
1062398486 9:136362280-136362302 TGCCACAGGAGTGCTGGGCCTGG - Intronic
1062631123 9:137463600-137463622 TGCCACTGCAGTCCTGGAGCTGG + Intronic
1186326397 X:8482092-8482114 TGCCAGGGATGTCTTGGGCATGG + Intergenic
1189234438 X:39476714-39476736 TGACACAGCAGTGCTGGGAAGGG + Intergenic
1196519603 X:116657749-116657771 TCCCATGACAGTCCTGGGCAAGG + Intergenic
1198095546 X:133376664-133376686 TGCCAAGGCAATCCAGGTCATGG - Intronic