ID: 1072637201

View in Genome Browser
Species Human (GRCh38)
Location 10:97185729-97185751
Sequence ACCTGGAGGCGGCCCCGGAC GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 152
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 138}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1072637201_1072637213 13 Left 1072637201 10:97185729-97185751 CCCGTCCGGGGCCGCCTCCAGGT 0: 1
1: 0
2: 0
3: 13
4: 138
Right 1072637213 10:97185765-97185787 AGAGCCACCGAAGAGCCCGCGGG 0: 1
1: 0
2: 0
3: 6
4: 75
1072637201_1072637212 12 Left 1072637201 10:97185729-97185751 CCCGTCCGGGGCCGCCTCCAGGT 0: 1
1: 0
2: 0
3: 13
4: 138
Right 1072637212 10:97185764-97185786 CAGAGCCACCGAAGAGCCCGCGG 0: 1
1: 0
2: 0
3: 4
4: 113
1072637201_1072637216 24 Left 1072637201 10:97185729-97185751 CCCGTCCGGGGCCGCCTCCAGGT 0: 1
1: 0
2: 0
3: 13
4: 138
Right 1072637216 10:97185776-97185798 AGAGCCCGCGGGCTTGCGCGCGG 0: 1
1: 0
2: 0
3: 4
4: 65

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1072637201 Original CRISPR ACCTGGAGGCGGCCCCGGAC GGG (reversed) Exonic
901630716 1:10646945-10646967 TCCTGGAGGCGGCCTAGGGCAGG - Intronic
901686840 1:10947915-10947937 ACCTGGAGTCAGCCCCTGGCTGG - Exonic
903363811 1:22793675-22793697 GCCTGGAGGAGGCCCGAGACAGG + Intronic
904627214 1:31813950-31813972 CCCAGGAGGCTGCCCCAGACTGG - Exonic
906318021 1:44800534-44800556 ACTCGGAGGCGGCCCGGGCCCGG - Exonic
907248609 1:53123309-53123331 CCCTGGAGTCTGCCCCGCACAGG + Intronic
912670456 1:111619908-111619930 AGGTGGAGGAGGCGCCGGACCGG + Exonic
912911018 1:113759239-113759261 CCCTGTAGGCGGCCTCTGACCGG - Exonic
915558881 1:156675215-156675237 GCCTGGAGGTGGCCACGTACAGG - Exonic
916233305 1:162561498-162561520 ACGCGGAGGCGGCCGCGGCCCGG - Intronic
922871627 1:228906738-228906760 ACCTGGGGGCAGCCCAGAACTGG + Intergenic
924385448 1:243495236-243495258 AGAGGGAGGCGGCCCCGCACAGG - Intronic
1063292979 10:4769851-4769873 ACCTGGAAGGGGGCACGGACCGG + Intergenic
1064230874 10:13528765-13528787 ACCGGGAGGCGGCGCCGCGCGGG - Intronic
1067219734 10:44335484-44335506 AACTGGAGACTGCCCCGGACAGG - Intergenic
1069774270 10:70917741-70917763 AGCTGGGGTGGGCCCCGGACTGG - Intergenic
1070324839 10:75381692-75381714 ATCTGGAGGCAGCCCAGGATTGG - Intergenic
1070327747 10:75399490-75399512 AGCTGGCGGCGGCCGCGGCCGGG - Exonic
1070767880 10:79067116-79067138 ATCAGGAGGCGGCTCCGGCCAGG + Intergenic
1070767904 10:79067178-79067200 ACCCGGAGGCGGCCCAGGCGGGG - Intergenic
1070800559 10:79242567-79242589 AACTGGAGGGGGCCTCGGCCGGG - Intronic
1072637201 10:97185729-97185751 ACCTGGAGGCGGCCCCGGACGGG - Exonic
1072656762 10:97335005-97335027 CCCAGGAGGCGGGCCCGGAGTGG - Intergenic
1072682771 10:97518421-97518443 AGCTGGAGGCAGCCTCGGGCCGG - Intronic
1075995601 10:126873879-126873901 ACCAGGAGGGAGCCCCGGAAAGG - Intergenic
1076510203 10:131008046-131008068 ACCTGGAGGGGGCATTGGACAGG + Intergenic
1077080445 11:722533-722555 AGCTGGATGCGGCCCCGGTAGGG + Exonic
1077160026 11:1108439-1108461 ACCTGGAGGAGGCCCCAGGCTGG - Intergenic
1077249168 11:1553173-1553195 CCCTGGAGGCAGCCCCAGCCCGG - Intergenic
1079076873 11:17389570-17389592 ACAGGGCGGCGGCCCCAGACTGG - Intergenic
1081720704 11:45286256-45286278 GCCTGGAGGCGGGCCCGGCCCGG - Exonic
1083290376 11:61686622-61686644 ACCTGGAGACGGTCCTGGCCAGG + Intronic
1083965671 11:66042435-66042457 ACATGGAGGCAGCCCCTGGCTGG + Exonic
1084144298 11:67255967-67255989 AGCTGGAGGCGGCAGAGGACTGG + Exonic
1088952816 11:114588182-114588204 AGCTGGAGGGGGCCCCAGAGAGG - Intronic
1089161085 11:116437899-116437921 AGTTGGAGGCGGCCCTGGAGAGG + Intergenic
1089533905 11:119149343-119149365 ACCTTGACGCGCCCCCGGGCCGG - Exonic
1089599220 11:119603220-119603242 AGCTGGAGGCCGCCCAGGAGCGG - Intergenic
1092239903 12:6829989-6830011 ACCTGGAGACGCCCCCACACTGG + Exonic
1092335478 12:7629056-7629078 ACAGGGAGGCGGCCCGGGCCGGG - Intergenic
1092446689 12:8564524-8564546 ACAGGGAGGCGGCCCGGGCCGGG + Intergenic
1094219338 12:27975428-27975450 ACCCCGACGCGGCCCCGGACAGG - Intergenic
1113948498 13:114058248-114058270 ACCTGGAGCTGGCCCCTGCCGGG - Intronic
1116514514 14:45788887-45788909 ACCAGGAGGAGGCCCTGGAAAGG + Intergenic
1121022945 14:90592821-90592843 ACCTGGAGACTGGCCCGGAAGGG - Intronic
1122707407 14:103629676-103629698 ACCTGGAAGGGGTCGCGGACCGG - Intronic
1132720264 16:1312195-1312217 GGCTGGAGGCAGCCCCAGACCGG - Intronic
1132841313 16:1979656-1979678 ACCTAGAGGAAGCCCCGAACCGG - Exonic
1133013967 16:2930442-2930464 ACCAGGAGGCGGCCCCCGAATGG - Exonic
1134290881 16:12902199-12902221 CTCCGGAGGCGGCCCCGGAGCGG - Exonic
1134628135 16:15737448-15737470 AGCTGCAGGCGGCCCTGGCCAGG - Exonic
1136028459 16:27485296-27485318 GCCTGGAAGGGGCCCTGGACTGG + Intronic
1137426382 16:48384856-48384878 CCCGGGAGGCGGGCCCGGCCGGG - Intronic
1138512746 16:57518143-57518165 ACCTGGAGGAGGCGCTGGCCCGG - Exonic
1141095440 16:81159711-81159733 ACCTGGAGCCAGCCCCCGGCAGG - Intergenic
1142670595 17:1485874-1485896 ACCTGGAGGGGACCCCAGCCCGG - Intronic
1142960056 17:3547069-3547091 ACCTGGAGGTGGCTGCAGACAGG - Intronic
1143476021 17:7204487-7204509 ACATGCAGGGGGCCCCGGGCTGG - Intronic
1143628844 17:8125681-8125703 AGGTTGAGGCGGACCCGGACAGG - Intergenic
1145881871 17:28357896-28357918 ACAAGGAGGGGACCCCGGACTGG - Intronic
1147339547 17:39745513-39745535 CCCTGGAGGAGGCCCAGGCCTGG + Exonic
1149549946 17:57532767-57532789 AGCTGGAGGCGGCGCCAGCCAGG - Intronic
1151901114 17:77015921-77015943 ATCTGGAGGTGGCCCGGGGCTGG + Intergenic
1152258736 17:79255159-79255181 TCCTGGAGGCAGCACCAGACTGG - Intronic
1152388660 17:79990278-79990300 ACCTGGAGCCGGCCCCTCGCTGG - Intronic
1152458757 17:80430623-80430645 GCCTGGAGGGGGCCGAGGACGGG + Intronic
1152514103 17:80812058-80812080 ACCTGGAGGAGGCCCCAGGTAGG - Intronic
1153640793 18:7155290-7155312 TCCTGGAGGAGGCCACGGTCTGG - Intergenic
1153942617 18:9990925-9990947 ACTGGGAGGCCGCCCCGGTCTGG - Intergenic
1159787667 18:72733627-72733649 TCCTGGAGGCTGCCCCTGCCTGG + Intergenic
1160242262 18:77132482-77132504 ACCTGGGCGGGACCCCGGACCGG - Intronic
1160988980 19:1852897-1852919 ACCTGGACCCAGCCCCGGCCTGG - Exonic
1161015560 19:1981117-1981139 GCCTGGGGGCGGCCCTGGACTGG + Exonic
1161087324 19:2341098-2341120 CCCTGGAGGCCGCCCCAGCCTGG + Exonic
1161487478 19:4543788-4543810 CCCTGGAGCCCGCCCCCGACGGG - Exonic
1161736407 19:5994808-5994830 ACCTCGAGGAGGCGCCGGCCGGG + Exonic
1163008962 19:14412926-14412948 AACTGGAGGCGGCACCGCTCTGG + Intronic
1165774333 19:38395867-38395889 ACCAGGAGGCGACCCGGGTCCGG - Exonic
1165956487 19:39504667-39504689 TCCTGGAGGTGGCCCGGGGCTGG + Intronic
1166079341 19:40434029-40434051 CCCGGGAGGCGGCCGCGGCCGGG - Intergenic
1166518052 19:43461805-43461827 TCCTGGACACAGCCCCGGACAGG + Exonic
1167301554 19:48680674-48680696 ACCTGCAGCGGGCCCTGGACTGG + Intergenic
1167325126 19:48819674-48819696 ACCTGGAGGCTGGCCCGTTCAGG - Intronic
1167379522 19:49130430-49130452 AGCTGGAGGAGGCCCTGGAGCGG + Exonic
1168153897 19:54462876-54462898 AGCTGGAGGCGGCCCAGGAGAGG - Exonic
925450947 2:3968758-3968780 ACCTGGAGGGGGCATCGGAAGGG + Intergenic
926364024 2:12116374-12116396 ACCTGGAGGTGGTCACGGATGGG + Intergenic
927214099 2:20656734-20656756 GCCTGGAGGAGGCCCAGGGCAGG + Intergenic
928683691 2:33727519-33727541 ACCTGGACCCGGGCCCGGCCCGG - Intergenic
932572675 2:72946133-72946155 CCCAGGAGGGGGCCCCGGAGTGG - Intronic
935088987 2:99876111-99876133 AAGTGGAGGAGGCCCAGGACTGG - Intronic
942558652 2:177198165-177198187 AGCTGGAGGCGGCCCTGCAGCGG + Intergenic
947718581 2:232354041-232354063 ACCTGGAGGATGCCTAGGACGGG + Intergenic
947731064 2:232432080-232432102 ACCTGGAGGATGCCTAGGACTGG + Intergenic
948600651 2:239105925-239105947 ACCTGGAGGGGCACCCGCACTGG + Intronic
948626676 2:239273632-239273654 AGCTGGAGCCTGCGCCGGACCGG - Intronic
948828743 2:240587035-240587057 ACGTGGAGGCGGCCCCAGGTGGG + Exonic
1170714870 20:18822986-18823008 ATCTGCAGGCGGCCCTGGAATGG + Intronic
1171456896 20:25277259-25277281 ACATCGAGGCGGTCCTGGACCGG + Exonic
1173259228 20:41418648-41418670 ACCTGGGGGCTGGCCCTGACAGG + Intronic
1175286520 20:57840424-57840446 ACCAGGATGCGGCCCCAGGCAGG + Intergenic
1176173627 20:63707659-63707681 ACCTGGAGGCGGCGCGCGGCTGG + Intronic
1180052951 21:45341290-45341312 ACCTGGAGGCAGCTCCTGCCTGG + Intergenic
1181439896 22:22930346-22930368 TCCTGGAGGCAGCCCAGGCCTGG - Intergenic
1184649454 22:45912997-45913019 ACCTGGAGGCAGCCCAGGGTTGG - Intergenic
1185053090 22:48563857-48563879 ACCTGGAGGCGGGCTGGGCCAGG - Intronic
950006663 3:9695874-9695896 ACCTGGAGGGGGCACAGGGCAGG + Intronic
954744180 3:52777772-52777794 ACCTGGATGAGGCCCCGGGCGGG + Intronic
962274442 3:134001446-134001468 CACTGGAGGCTGCACCGGACTGG + Intronic
962826667 3:139105472-139105494 CCCTGGAAGCAGCCCCGGGCTGG + Intronic
962865803 3:139447300-139447322 CACAGGAGGCGGCCCCTGACAGG - Intergenic
968293162 3:197554786-197554808 GCCTGGAGGCGGCCGCGCGCAGG + Intronic
968458977 4:714372-714394 ACCTGTGAGCGGCTCCGGACAGG + Intronic
968659967 4:1794806-1794828 ACCCGCAGCCGGCTCCGGACGGG + Intronic
976235382 4:82891170-82891192 ACGTGGAGGTGGCCCTGGCCGGG - Exonic
976256709 4:83107864-83107886 ACCTGGAGTCGGTCCCGGTCCGG - Exonic
983792231 4:171813026-171813048 AGGTGGAGGCGACCCGGGACAGG - Intronic
985400446 4:189588180-189588202 ACCTGGGGGCGGCCTGGGAGCGG - Intergenic
990581825 5:57173574-57173596 ACTCCGAGGCAGCCCCGGACGGG + Intergenic
1005940563 6:30556604-30556626 ACCTGGAGGGGGCGGCGGAGCGG + Exonic
1006116895 6:31780368-31780390 ACATGGAGGCTGCTCCGGACAGG + Intronic
1006787541 6:36678653-36678675 TCCTTGAGGCGGGCCCGGGCGGG + Intronic
1006925208 6:37650227-37650249 CCCTGGAGGAGACTCCGGACGGG - Exonic
1008074442 6:47131286-47131308 ACCTGGTGGTGGCCCTGGATCGG - Intergenic
1011627562 6:89296054-89296076 CCCTGGAAGCAGCCCCTGACAGG - Intronic
1015366386 6:132401576-132401598 CCCTGCAGGCGGCCCGGGGCGGG - Intergenic
1019606267 7:1911773-1911795 ATCTGGAGGTGACGCCGGACTGG - Intronic
1020112039 7:5452640-5452662 ACCTGGAGGCTGACCAGGCCTGG - Intronic
1020137472 7:5594876-5594898 GCCTGCAGGAGGCCCCGGAGGGG - Intronic
1022710537 7:32845038-32845060 CCCTGGAGGCGGCCCAGGAGAGG + Intergenic
1022914129 7:34929884-34929906 CCCTGGAGGCAGCCCAGGAGAGG - Exonic
1023849393 7:44141680-44141702 GCCTGGCGGGGGCCCTGGACTGG - Intergenic
1023874947 7:44281857-44281879 TCCTGGAGGTGGCCCCTGGCCGG - Intronic
1027031362 7:74890952-74890974 ACCTCGTGGAGGCCCCGGAGCGG + Intergenic
1029492922 7:100882032-100882054 GCCTGGAGGGGACCCCGGTCAGG - Exonic
1032083124 7:128869857-128869879 CCCTGGAGTGGGCCCCGCACCGG - Intronic
1033656994 7:143381319-143381341 GGCTGGAGGCTGCTCCGGACCGG + Exonic
1035642467 8:1194429-1194451 ACCTGGAGGCCGCCCTGGGCAGG - Intergenic
1037323973 8:17670245-17670267 ACCTGGGGGCAGCCCCTCACTGG + Intronic
1045651854 8:104348690-104348712 ACCAGCAGGCGGCCACAGACAGG - Exonic
1049232098 8:141489769-141489791 CCCAGGAGGTGGCCCAGGACAGG - Intergenic
1049615169 8:143572774-143572796 ACCTAGAAGCCGCCCCGGGCGGG + Exonic
1049743939 8:144255086-144255108 ACCTGGAGGCAGCACCGGGCTGG + Intronic
1052996425 9:34553750-34553772 GCCTGGAAGGGGCGCCGGACAGG - Intronic
1056691567 9:88812628-88812650 ACCTGGTTGGGGCCCCGCACTGG - Intergenic
1060405584 9:123371426-123371448 TCCTGGAGGCAGCCTCGGAAGGG - Exonic
1060812642 9:126618775-126618797 TCCTGGAGGAGGCTCCGGAAGGG + Intronic
1062565956 9:137164071-137164093 ACCTGCAGGCAGCCCCCCACCGG - Intronic
1062600873 9:137318130-137318152 ACCTGGAGCCTGCCGTGGACAGG - Intronic
1185774956 X:2794583-2794605 ACCTGCAGGCGGCCGTGGCCTGG - Exonic
1189323166 X:40098119-40098141 AGCTGGAGGCGGCGGCGGGCGGG - Intronic
1197809152 X:130426249-130426271 AACTGGAGGTAGCCCCGGGCTGG + Intergenic