ID: 1072637629

View in Genome Browser
Species Human (GRCh38)
Location 10:97187786-97187808
Sequence CAGGTGCTGGGGTGTGTGTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 512
Summary {0: 1, 1: 0, 2: 0, 3: 52, 4: 459}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1072637629_1072637636 11 Left 1072637629 10:97187786-97187808 CCAGACACACACCCCAGCACCTG 0: 1
1: 0
2: 0
3: 52
4: 459
Right 1072637636 10:97187820-97187842 GCCTGTCACAGACAGCACTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1072637629 Original CRISPR CAGGTGCTGGGGTGTGTGTC TGG (reversed) Intronic
900118720 1:1039664-1039686 CTGGTGATGGGACGTGTGTCAGG + Intronic
900149411 1:1171619-1171641 CAGGTCCTGGGCTGAGTGGCTGG - Intergenic
900200203 1:1401296-1401318 CAGTTGCTGGGGAGTCTTTCCGG - Intronic
900371239 1:2333104-2333126 CAGGTGTTGGGGGGCGTGACTGG + Intronic
900448740 1:2694906-2694928 CAGGTGCTCGCGTGAGTGTGTGG - Intronic
900452209 1:2755858-2755880 CAGGTGCTCGCGTGAGTGTGTGG - Intronic
900505376 1:3027708-3027730 CAGGAGCTGGCCTGGGTGTCAGG - Intergenic
900594422 1:3474285-3474307 CATGTGCGGGGCTGTGTGTATGG - Intronic
900948421 1:5844176-5844198 CAGGTGCTGGTGTGGGGCTCAGG - Intergenic
900958695 1:5905615-5905637 CAGGAGGTGAGGTGTGGGTCTGG - Exonic
901051730 1:6428894-6428916 CAGGAGGTGGGGTGGGGGTCTGG - Intronic
901367938 1:8769928-8769950 CAGGTGCAGTGGTGTGCGCCCGG - Intronic
902177959 1:14665536-14665558 TAGGGGCTGGGGTGGGTGTGGGG + Intronic
902308916 1:15565404-15565426 CAGGTGCTGTGTTGGGTGCCAGG - Intronic
902884596 1:19395703-19395725 CAGGTGATGGGTTGTGTGCCTGG - Intronic
904043150 1:27595604-27595626 GAGGAGCTGGGGAGTGTCTCTGG + Intronic
904829013 1:33294883-33294905 GCGGTCTTGGGGTGTGTGTCAGG + Intronic
905171511 1:36112584-36112606 CAGGTGCTGGGCTGAGTTTTGGG - Intronic
905202936 1:36326069-36326091 CAGGATCTGGGGAGAGTGTCTGG + Intronic
909291805 1:73892392-73892414 CAGGAGCTGGGGTGTAGGGCGGG - Intergenic
911381375 1:97119415-97119437 CAAATGCTGGTGTGTGTGTGTGG + Intronic
912367838 1:109149626-109149648 CAGGTGCTGTTCTGGGTGTCTGG + Intronic
912464726 1:109864051-109864073 CAGGAGCTGGGGTGGGAGTGGGG - Intergenic
912550370 1:110481577-110481599 CAGGTGCTCAGGTTTGAGTCTGG + Intergenic
912631298 1:111248799-111248821 CAGGTGATGGTGTGTGACTCAGG - Intergenic
912697508 1:111852469-111852491 CTGGTGCTGGGCTCTGTCTCCGG + Intronic
913255078 1:116945526-116945548 CAGCTGTTGGAGTGTGTGCCTGG + Intronic
913651606 1:120919452-120919474 CAGGAGCTGGGGTGGCTGTGGGG + Intergenic
914169500 1:145209618-145209640 CAGGAGCTGGGGTGGCTGTGGGG - Intergenic
914641787 1:149613560-149613582 CAGGAGCTGGGGTGGCTGTGGGG + Intergenic
915605264 1:156946436-156946458 CAGGTGCTGGTGGGTGAGCCAGG + Intronic
915908246 1:159895443-159895465 CAGGTGCTGGGGTGTCTGGTTGG - Intronic
916725196 1:167517189-167517211 CAGCTGCAGGGGTTTCTGTCAGG - Intronic
918395678 1:184111083-184111105 TATGTGGTGGGGTGTGTGACGGG - Intergenic
918616749 1:186553127-186553149 GGGTTGCTGGGGTGTTTGTCAGG + Intergenic
919540362 1:198837769-198837791 CAGGTGCTGCTCTGGGTGTCAGG - Intergenic
919677172 1:200395055-200395077 CACTTGATGGGGTGTGTGGCTGG + Intergenic
919816997 1:201448021-201448043 CAGGTGCTGGGGGCAGTGTGGGG + Intergenic
919843475 1:201626286-201626308 GAGGTGCTGGGGCGGGTGGCAGG - Intronic
919910329 1:202107020-202107042 CAGATACTGGGATGTGAGTCTGG + Intergenic
920172789 1:204082061-204082083 CTGGTGGTGGGGTGTGTGTGGGG + Intronic
921413430 1:214861736-214861758 CATGTGCTGTTGTCTGTGTCTGG + Intergenic
922178328 1:223214567-223214589 AAGGAGCTGGGATGAGTGTCAGG + Intergenic
922427173 1:225509495-225509517 AAGGAGCTCGGGTGTGTTTCAGG + Intronic
922562492 1:226579366-226579388 CAGGTGCTGGGCTGCGTGCTGGG + Intronic
923026462 1:230208467-230208489 TAGGTGGTGGGATATGTGTCTGG + Intronic
923494746 1:234514322-234514344 TAGGTGCTGGGGGGTGGGTCAGG + Intergenic
923604893 1:235434201-235434223 CAGGTGCTGCGGTGTGTCGCGGG + Exonic
1063173382 10:3529813-3529835 CAGGTGCTGTCCTGTGGGTCAGG - Intergenic
1063346314 10:5315307-5315329 CAGGGTCTGGGGTGTGTGGTTGG + Intergenic
1064795703 10:19008908-19008930 CATGTGCTGGGGGTTGGGTCAGG - Intergenic
1065943875 10:30589461-30589483 CAGGTGCTGGGTTGTGTCAGTGG + Intergenic
1067084347 10:43229998-43230020 TAGGTGCCGGGGTGTGAGGCTGG + Intronic
1067177824 10:43962541-43962563 CTGGTGCTTGGGTTTGTGTGGGG + Intergenic
1067476769 10:46572615-46572637 CTGGTTCTGGAGTGGGTGTCAGG - Intergenic
1067554805 10:47261389-47261411 TAGGTTCAGGTGTGTGTGTCAGG - Intergenic
1067617969 10:47769165-47769187 CTGGTTCTGGAGTGGGTGTCAGG + Intergenic
1067997416 10:51289688-51289710 GAGTTTGTGGGGTGTGTGTCTGG + Intronic
1068821641 10:61383662-61383684 CAGGGGTTGGGGTGTGTGGGTGG - Intergenic
1070195212 10:74150743-74150765 CAGGTGTTGGGGTGAGTGTGAGG - Exonic
1072555812 10:96513214-96513236 CAGGGGCCGGGGTGGGTGCCAGG - Intronic
1072637629 10:97187786-97187808 CAGGTGCTGGGGTGTGTGTCTGG - Intronic
1072663599 10:97378713-97378735 CAGGTGCAGTGGTGGGTGCCTGG + Intronic
1072789331 10:98306249-98306271 CAGGATCTGGGATGTGTGTGTGG - Intergenic
1073197766 10:101707646-101707668 CATGTGTTTGCGTGTGTGTCAGG - Intergenic
1073463655 10:103681202-103681224 CAAATGCTGGGCTGTGTTTCAGG + Intronic
1073582996 10:104684541-104684563 CAGGGGCTGCGGTGTGTTTGTGG + Intronic
1074092374 10:110273604-110273626 CACGTGCAGGAGTGTGTGTTGGG + Intronic
1075175904 10:120160838-120160860 CAGATTCTGGGGTGGGTGTGGGG + Intergenic
1075545420 10:123351317-123351339 CAGGGGCTGGGGTGTGCCTTGGG + Intergenic
1075631677 10:124004273-124004295 TAGGTGCTGGGCACTGTGTCTGG - Intergenic
1075743627 10:124711149-124711171 CAGGTTGTGGCGTGTGTCTCTGG - Intronic
1076270805 10:129150556-129150578 CAGGTGCTGAGGCATGGGTCAGG - Intergenic
1076453098 10:130570474-130570496 CAGGAGCACAGGTGTGTGTCAGG + Intergenic
1076731980 10:132443858-132443880 CAGCAGCTGGGGTGTCTGTGGGG + Intergenic
1076756796 10:132576837-132576859 CGGGTTCTGGGGTGTGAGTCTGG - Intronic
1076824049 10:132958335-132958357 CAGGACCTGGGGTGTGGGGCAGG + Intergenic
1077071498 11:676077-676099 CAGGTGCTGGGGGGGATGTCGGG - Intronic
1077177322 11:1196735-1196757 CCGGGGCTGGGGGGTGTGGCAGG + Intronic
1077180276 11:1209162-1209184 CAGGTGCTGAGGCCGGTGTCGGG - Intergenic
1077367172 11:2165960-2165982 CAGGGCCTGGGGTGTGGGTTTGG - Intronic
1077442835 11:2576717-2576739 CTGGTGCAGGGGTGTGCGTGAGG + Intronic
1077980661 11:7297003-7297025 CAGATGATTGTGTGTGTGTCAGG - Intronic
1080244549 11:30164517-30164539 CAGGTGGTGGGGTGGGGGTGAGG + Intergenic
1081797594 11:45832087-45832109 TGGGTGCTGGGGTGTCTGTGTGG - Intergenic
1083052367 11:59788726-59788748 CAGATGCTGGGGAGTGCGTAGGG + Intronic
1083552250 11:63598744-63598766 CAGGTGTTGGGGAGTGTCTGTGG - Intronic
1084032423 11:66488746-66488768 CAGGGGCTGGGGTGCGAGTGGGG - Intronic
1084319721 11:68366529-68366551 CAGCGGCTGGGGTGTGTGTGTGG + Intronic
1084944715 11:72632432-72632454 CAGTGACTGTGGTGTGTGTCTGG + Intronic
1084963854 11:72733219-72733241 CCAGTGCTGGGATGTGTGTAGGG + Intronic
1085280229 11:75325254-75325276 TAGGGGCTGGGGTGAGGGTCGGG - Intronic
1085408482 11:76277908-76277930 CAGGGGCTGGGCTCTGTGGCTGG + Intergenic
1085557646 11:77439807-77439829 CAGGTGCCTGGGTCTGTATCAGG + Intronic
1085580140 11:77643247-77643269 CAGCTACTCGGGTGTCTGTCAGG - Intergenic
1087025433 11:93644819-93644841 CAGTTGCTGTGGGGCGTGTCTGG + Intergenic
1088257788 11:107917082-107917104 CAGGTACTGGGGAGTGTTTTTGG - Intronic
1089087884 11:115839187-115839209 CAGGTGCTGGGGAGGATGTGGGG + Intergenic
1089300396 11:117495283-117495305 CAGGTGCTGGGGAGGATATCAGG - Intronic
1089301592 11:117502202-117502224 CAGGAGCTGGGCTGTGTGTGAGG - Intronic
1089677660 11:120100633-120100655 CGGGAGCTGGGGTGTGGGGCAGG - Intergenic
1089684732 11:120139454-120139476 CAGGTTCTGGGCTGTGTGGAGGG + Intronic
1089855190 11:121537377-121537399 CTGATGCTGGGGTGTGTTTGAGG + Intronic
1090834063 11:130441038-130441060 CATGTGCCTGGGTGTTTGTCAGG + Intergenic
1091010446 11:131996287-131996309 CAGGTGCAGGGGAGGGGGTCAGG - Intronic
1092406853 12:8227515-8227537 CAGGTGCAGGGCTATGCGTCAGG + Exonic
1095225403 12:39672206-39672228 CAGATGCAGGGGTGTGTGGAAGG + Intronic
1096161991 12:49386526-49386548 CAGCTGCAGGGGTGTATGTTTGG + Intronic
1096181080 12:49550651-49550673 GAAGTGCTGGGGAGAGTGTCAGG + Intronic
1096239318 12:49951107-49951129 CAGCTGCTGGGGGCTGTGGCCGG + Exonic
1096804667 12:54133284-54133306 CAGGTGCCAGTGTGTGTGTGTGG + Intergenic
1097777836 12:63668688-63668710 CAGGCGCTGGGGAGGGTGTGGGG - Intronic
1097854982 12:64452385-64452407 CTGCCTCTGGGGTGTGTGTCGGG + Intronic
1098805923 12:75020128-75020150 CAGGGAGTGGGGAGTGTGTCAGG + Intergenic
1101413741 12:104490986-104491008 CAGGTGCTGTGCTGGGTGGCAGG + Intronic
1103585149 12:121947563-121947585 CAGGCGCTGTGGTGTATGCCTGG - Intronic
1103930544 12:124448492-124448514 CAGGGGCTGCAGAGTGTGTCAGG - Intronic
1103936992 12:124482226-124482248 GAGGGGCTGGGGTGTCTGTGTGG - Intronic
1104509112 12:129360193-129360215 GAGGTTGTGGGGTGTGTCTCTGG - Intronic
1104743405 12:131194968-131194990 CACCTGCAGGTGTGTGTGTCTGG - Intergenic
1104790928 12:131481716-131481738 CACCTGCAGGTGTGTGTGTCTGG + Intergenic
1104878863 12:132055474-132055496 GAGGTGTAGGGGTGTGTGTGAGG + Intronic
1104878869 12:132055514-132055536 GAGGTGTAGGGGTGTGTGTGAGG + Intronic
1104878877 12:132055555-132055577 GAGGTGTAGGGGTGTGTGTGAGG + Intronic
1104878893 12:132055632-132055654 GAGGTGTAGGGGTGTGTGTGAGG + Intronic
1104948390 12:132427526-132427548 CAGGGCCTGGGGTGGGTGGCTGG + Intergenic
1105765728 13:23556993-23557015 CATGTGCTTGAGTGTGTGTATGG + Intergenic
1106182620 13:27381707-27381729 CAGGTGCTGGGGGGTTCGTTTGG + Intergenic
1106227009 13:27793298-27793320 CAGGTCCTGGAGTGTGGGCCGGG + Intronic
1106545810 13:30730535-30730557 CAGGAGGTGGGGTCTGTGCCAGG - Intronic
1106819852 13:33452337-33452359 CAGTTGTGGGGGTGGGTGTCAGG + Intergenic
1107123312 13:36819050-36819072 CAGGGTCTGGGGGCTGTGTCAGG - Intergenic
1107747184 13:43523084-43523106 GAGGGACTGTGGTGTGTGTCAGG - Intronic
1108180622 13:47836650-47836672 TAGGTGCTGGGCACTGTGTCTGG - Intergenic
1108596749 13:51956072-51956094 CAAGTGCTGGGGAGTGAGCCTGG + Intronic
1109307460 13:60656671-60656693 CAGGTGCAGAGGTGTCTGTGAGG + Intergenic
1113727561 13:112616537-112616559 CAGGTGCTGGGATCTGGGTTTGG + Intergenic
1113927115 13:113947730-113947752 CATCTGCTTGGCTGTGTGTCCGG - Intergenic
1113958419 13:114112093-114112115 CAGTTGCTGGGGGGGGTGCCTGG - Intronic
1114635991 14:24187184-24187206 CAGCTGCTGGGGTGTGAGATTGG - Intronic
1114646661 14:24259883-24259905 GAGGAGCTGGGGTGGGTGTGGGG - Intronic
1115961477 14:38838644-38838666 AAGGTGCAGGGGTGTGTGTGGGG - Intergenic
1116844577 14:49853358-49853380 CAGGTACTGCGGTGAGTCTCAGG - Intergenic
1117146949 14:52845343-52845365 CATGTGCTGGTGTCTGTTTCTGG + Intergenic
1117913575 14:60655880-60655902 CAGGGTCTGGGGTTTGGGTCAGG - Intronic
1118011146 14:61611806-61611828 CAGGTGCTGCAGTATGTGCCAGG - Intronic
1118316055 14:64726768-64726790 CAGGTGCTGGGGTGGGGCTGCGG + Intronic
1118348209 14:64955088-64955110 AAGATGGTGGGGTGTGTGTGAGG - Intronic
1118689507 14:68324457-68324479 CATGTGCTGGGCTGTGTGCCAGG - Intronic
1119386510 14:74260788-74260810 AAAGTGCTGGGGACTGTGTCTGG + Exonic
1119640085 14:76308379-76308401 CAGGCTCAGAGGTGTGTGTCCGG + Intergenic
1120881197 14:89416728-89416750 CAGGTCCTGGGGGGAGGGTCGGG - Intronic
1121879212 14:97485042-97485064 CAGGTGCTGGGCAGTTTGGCTGG + Intergenic
1122209901 14:100167283-100167305 TAGGGGGTGGGGTGTGTGTTGGG - Intergenic
1122398169 14:101450021-101450043 GAGGTGCTGGGGAGTGTGTAAGG - Intergenic
1122428216 14:101623843-101623865 CAGGTGCTGGGGTGACAGACAGG - Intergenic
1123032590 14:105458868-105458890 CGGGTTCTGGGGTGGGTGCCGGG + Intronic
1125191801 15:37002254-37002276 CAGGTGATGGGGTGGGGGTGGGG - Intronic
1125590774 15:40853401-40853423 CAGGGGTGTGGGTGTGTGTCTGG + Intronic
1125933584 15:43616637-43616659 CAGGCGCTGGGCTTTCTGTCTGG - Exonic
1125946682 15:43716099-43716121 CAGGCGCTGGGCTTTCTGTCTGG - Intergenic
1126075969 15:44910011-44910033 CTAGGGCTGGGGTGTGTGTTGGG + Intergenic
1126798933 15:52282718-52282740 CGGTAGCTGGGGTGTGTGTAAGG - Intronic
1128244860 15:66126200-66126222 CAGGGACCGGGGTGTGTTTCTGG + Intronic
1129136380 15:73555961-73555983 CAGGTGCTGGAGGGTGGGCCCGG - Intronic
1129787236 15:78317532-78317554 CCCGTGCTGGGCTGGGTGTCAGG - Intergenic
1130380340 15:83366569-83366591 CAAATTCTGAGGTGTGTGTCTGG + Intergenic
1130926251 15:88387995-88388017 GAGGGGCTGGGGTGAGTGTGTGG - Intergenic
1131147705 15:90024807-90024829 CCGGTGTTGGGGTGGGTGGCAGG + Intronic
1131741918 15:95402074-95402096 CAGGCCCTGGGGAGTGTGTGGGG + Intergenic
1132336375 15:101050942-101050964 CAGGTGCTGGGCAGTTTGACAGG + Intronic
1132465546 16:75846-75868 CAGCTGTTGAGGTGGGTGTCAGG - Intronic
1132549396 16:548139-548161 CAGGAGCTGAGGCGTGTGGCAGG - Exonic
1132658942 16:1053102-1053124 CAGGTGGAAGGGTGTGTGCCCGG + Intergenic
1132715063 16:1286045-1286067 CCGGGTCTGTGGTGTGTGTCTGG - Intergenic
1133268371 16:4598428-4598450 CAGGGGCTGGGGTTTGGGGCGGG + Intronic
1134017004 16:10895671-10895693 CAGTTGATGGTGTCTGTGTCGGG - Exonic
1135059621 16:19259995-19260017 CAGGGACTGGGGAGTGTGTGGGG + Intronic
1136559809 16:31032703-31032725 CAGGGGCTGGGGGGTGTGAGTGG + Intergenic
1136569597 16:31088720-31088742 CATGTGCTGGGGTATGGGTGTGG - Intronic
1137568399 16:49548815-49548837 CAGGGGCAGGAGTGTGGGTCCGG - Intronic
1139083781 16:63560399-63560421 CATGTGTTGGGGTATGGGTCTGG - Intergenic
1139127067 16:64090888-64090910 AATGTGCTGAGGAGTGTGTCTGG + Intergenic
1139602250 16:67993751-67993773 CTGGTGCTGGGTTGTGTGGGTGG + Exonic
1140355139 16:74298730-74298752 CAGGTGTGGTGGTGTGTGCCTGG + Intronic
1140643326 16:77002626-77002648 CAGGGGCAGGTGTGTGGGTCAGG - Intergenic
1141393117 16:83681136-83681158 TGGGTGCTGGGGTCTGTGGCAGG - Intronic
1141733768 16:85839270-85839292 CAGGTGCTGGGGTGCATCTCAGG + Intergenic
1142158431 16:88544429-88544451 CAGGAGCTGTGGTGTTTGTTGGG + Intergenic
1142234435 16:88915185-88915207 CAGGTGGTGGCGTGGGTGTGGGG + Intronic
1142496966 17:311008-311030 CAGGTGCAGGGGAGTCTTTCGGG - Intronic
1142673636 17:1499734-1499756 CTGGAGGTGGGGTGTGTGTGTGG + Intronic
1143354253 17:6313651-6313673 CAGGTACTGGGCTGTGGGTTTGG - Intergenic
1144702702 17:17349304-17349326 TTGGTGCAGGGGTGTGGGTCGGG + Intergenic
1144767260 17:17739624-17739646 CAGGTGCTGGAATGTGTGGTGGG - Intronic
1144785777 17:17830812-17830834 CAGGGGCGGCTGTGTGTGTCGGG - Intronic
1145766759 17:27463567-27463589 GAGGTTCTGGGCTATGTGTCAGG + Intronic
1146419742 17:32672098-32672120 CATGTGCTGGGCTCTGTGCCAGG + Intronic
1147440533 17:40444433-40444455 ATGGTGGTGGGGTGTGTGTTGGG + Intronic
1147566789 17:41541321-41541343 CTGGTGCTGGGGTGAGTTGCCGG - Intergenic
1147648899 17:42050770-42050792 CAGGGGCTGGGGGGTGGGGCCGG - Intronic
1148129866 17:45256229-45256251 CCGGTGAGGGGGTGTGTGTGTGG + Intronic
1148437973 17:47696897-47696919 CAGATGCTGGGGGGTGTGGAGGG - Intronic
1148454893 17:47805890-47805912 CAGGTGGTGGGGTGGGAGTGGGG + Intergenic
1148586780 17:48786647-48786669 CAGGTGCTGGGGAGAGGGTCTGG + Intronic
1148612837 17:48975934-48975956 CAGGTGCTGGGATGTCAGCCTGG - Intergenic
1148965886 17:51435734-51435756 GAGATGCTGGGGAGTGTGTGGGG + Intergenic
1150333613 17:64314041-64314063 CAGGTGATGGAGAGTCTGTCAGG - Intergenic
1150646712 17:66983229-66983251 CAGGTGCTGGGGGGTGTCACAGG - Intronic
1150855190 17:68745576-68745598 CAGGTCGTGGGGTGTGTTTTGGG - Intergenic
1151305223 17:73258796-73258818 CAGGGGCTGGGCTGGGTGTGGGG - Intronic
1151333835 17:73428421-73428443 CAGGTGCAGGGGTGAGGGCCTGG - Intronic
1151484611 17:74390736-74390758 CAGGTGCGGGGGCGTGTGCCTGG - Intergenic
1151780087 17:76240088-76240110 CAGGGGCAGGGGTCTGGGTCGGG - Intronic
1151835423 17:76579818-76579840 CAGGTCATAGGGTCTGTGTCTGG - Intronic
1151877332 17:76874360-76874382 GAGGTGCTGGAGTGTCTGTGTGG + Intronic
1151890256 17:76947326-76947348 CAGGTGAGGGGGTGAGGGTCAGG + Intronic
1152256551 17:79243368-79243390 CAAGTGCTGGGGTGGGAGGCAGG - Intronic
1152505694 17:80748178-80748200 GAGGGGCTGCGGTGTGTGTTTGG + Intronic
1152505711 17:80748233-80748255 GAGGGGCTGCGGTGTGTGTTTGG + Intronic
1152505815 17:80748559-80748581 GAGGGGCTGCGGTGTGTGTTTGG + Intronic
1152505854 17:80748720-80748742 GAGGGGCTGCGGTGTGTGTTTGG + Intronic
1152505885 17:80748830-80748852 GAGGGGCTGCGGTGTGTGTTTGG + Intronic
1152505901 17:80748885-80748907 GAGGGGCTGCGGTGTGTGTTTGG + Intronic
1152505918 17:80748940-80748962 GAGGGGCTGCGGTGTGTGTTTGG + Intronic
1152505935 17:80748995-80749017 GAGGGGCTGCGGTGTGTGTTTGG + Intronic
1152505961 17:80749101-80749123 GAGGGGCTGCGGTGTGTGTTTGG + Intronic
1152505978 17:80749156-80749178 GAGGGGCTGCGGTGTGTGTTTGG + Intronic
1152506005 17:80749262-80749284 GAGGGGCTGCGGTGTGTGTTTGG + Intronic
1152506021 17:80749317-80749339 GAGGGGCTGCGGTGTGTGTTTGG + Intronic
1152506065 17:80749478-80749500 GAGGGGCTGCGGTGTGTGTTTGG + Intronic
1152506081 17:80749533-80749555 GAGGGGCTGCGGTGTGTGTTTGG + Intronic
1152506096 17:80749588-80749610 GAGGGGCTGCGGTGTGTGTTTGG + Intronic
1152848558 17:82617642-82617664 CAGCTGATGAGCTGTGTGTCTGG + Intronic
1152849902 17:82627417-82627439 CAGGTGCGGGTGTGTGTCTGAGG - Intronic
1152879958 17:82808938-82808960 CAGGTGCTGGGGGATGAGGCAGG + Intronic
1153723889 18:7936327-7936349 CAGGTGCAGGGGTGTCTTCCTGG - Intronic
1154253895 18:12766655-12766677 CGGGTGCTGCGTGGTGTGTCGGG - Intergenic
1156584438 18:38416082-38416104 CAGGTGCTGTAGTATGAGTCAGG + Intergenic
1156921382 18:42526763-42526785 CAGGTATTGGGGTTTGTGGCTGG - Intergenic
1157445445 18:47743273-47743295 CAAGTGCTGGGGGTTGGGTCTGG - Intergenic
1158950761 18:62492748-62492770 CAGGTGCTGGGGTATGAGGTGGG - Intergenic
1159608530 18:70499620-70499642 CAGGTGCTAGGGTGCGTCCCTGG + Intergenic
1160091881 18:75834741-75834763 CAGGTCCTGGGGTTAGTGTGCGG + Intergenic
1160536729 18:79598426-79598448 CAGGAGGTGGGGGGTGTGGCTGG - Intergenic
1160605184 18:80044798-80044820 CAGGTCTTGGGGTGTTTGTGGGG + Intronic
1161152051 19:2714707-2714729 CTGGTGCTGGGGACTGTGCCAGG - Exonic
1161834371 19:6635671-6635693 AAGGTGCTGAGGAGTGTCTCAGG - Intergenic
1161861528 19:6801690-6801712 CTGGTGCTGGGGTGGGGGTGGGG + Intronic
1162035033 19:7934020-7934042 GCGGGGCTGGGGTGGGTGTCTGG + Intronic
1162243922 19:9383041-9383063 CAGGTGCAGTGGTGCATGTCTGG + Intergenic
1162264915 19:9564222-9564244 CAGGTGTGGTGGTGTGTGCCTGG + Intronic
1162373048 19:10290279-10290301 CTGGGGCTCGGGTGTGTGTTGGG - Intronic
1162927109 19:13936204-13936226 CAGGAGCTGGGGTGGGGGTTGGG - Intronic
1163685944 19:18711667-18711689 CTGGTCCTGGGGTGGGTGCCGGG + Intronic
1163813697 19:19450637-19450659 AAGGTGCTGGGGGGTATGTGGGG + Intronic
1164394291 19:27850355-27850377 CAGGGGCGAGGGTGTGTGTGGGG + Intergenic
1164624981 19:29721340-29721362 CAGGGGCTGGGGGATTTGTCTGG - Intergenic
1164686110 19:30167764-30167786 CAGATGCTGGGGAGGGTGACGGG - Intergenic
1164851469 19:31487773-31487795 CATGTGCTGGGCTCTGTGCCAGG + Intergenic
1165097382 19:33417018-33417040 CAGGAGCTGGGCCGTGTGCCCGG - Intronic
1165122942 19:33574045-33574067 AATGTGCTGTGGTGTGTGTGGGG - Intergenic
1165384226 19:35501109-35501131 CTGGGGCTGGGGGGGGTGTCCGG - Intronic
1167074851 19:47242066-47242088 CATGTGCTGTGCTGGGTGTCGGG + Intergenic
1167622509 19:50567670-50567692 CAGGTTGTGGGGGGTGCGTCCGG - Intronic
1167648447 19:50717988-50718010 CCGGTGCTGGGGTGGGAGTTGGG - Intronic
1167660580 19:50793811-50793833 CAGGGGGTGAGGTGTGGGTCTGG + Exonic
925185973 2:1846655-1846677 GTGGTGCTAGGGTGGGTGTCCGG + Intronic
925370505 2:3341572-3341594 CAGGTGCAGGTGTGTATGTAAGG + Intronic
925851389 2:8085588-8085610 CAGGAGCTGGGGTGGGGGACTGG - Intergenic
926913488 2:17872609-17872631 CAGGTCCTAGTCTGTGTGTCTGG - Intergenic
927110540 2:19861193-19861215 TAGGGGCTGGGGTGGGTGTGGGG - Intergenic
927806234 2:26149227-26149249 CAGGAGCTGGGGTGGGAGTTGGG - Intergenic
929657616 2:43749790-43749812 CAGGTCCTTGGCTGTGTGACAGG - Intronic
930865931 2:56121804-56121826 GAGGTGCTGGGGCATTTGTCAGG + Intergenic
931278922 2:60770763-60770785 CAGGTGTGGTGGTGTGTGCCTGG - Intronic
931937403 2:67214355-67214377 CATGTGGAGGGGTGTGTGTGTGG - Intergenic
932633712 2:73369657-73369679 CAGGTGCTTGAGTGGGTGGCAGG - Intergenic
932781905 2:74564229-74564251 CACATGCTGGGGTGGGTGTAGGG + Intronic
934109227 2:88726204-88726226 CAGGTACTGGGGTGGGCGGCTGG + Intronic
934526521 2:95055607-95055629 CAGGGGCTGGGGTGTGAGGGTGG - Intergenic
934640247 2:96023559-96023581 CAGGTGCTGGGGCATGGCTCTGG - Intronic
934793404 2:97081859-97081881 CAGGTGCTGGGGCATGGCTCTGG + Intergenic
935194408 2:100803738-100803760 CAGTTGTGGGGGTGTATGTCAGG + Intergenic
937825589 2:126365400-126365422 GAGGGGATGGGGTGTGTGTGTGG + Intergenic
938071356 2:128310150-128310172 CAGGCCCTGGGCTGTGTGTTGGG - Intronic
938090968 2:128434564-128434586 CACGTGCGGGTGTGTGTGTATGG + Intergenic
943441844 2:187935107-187935129 CAGGTGCTGGAGTGTGGATGAGG + Intergenic
946238454 2:218339961-218339983 CAGGGGCTGGGGTATGTGAAGGG - Intronic
946329638 2:219002028-219002050 CAGGTGTGAGTGTGTGTGTCTGG - Intergenic
946432484 2:219633007-219633029 CAGGTGCCGGGGTGGGTCCCTGG + Exonic
948085268 2:235242165-235242187 CAGGTGCTGGGGTGCGGGGATGG - Intergenic
948464603 2:238146146-238146168 CAGGTGCTGGTGGGTGGGTGTGG - Intronic
948776654 2:240292532-240292554 CAGGTGCTGGGCTGTAGGCCTGG + Intergenic
948985196 2:241517451-241517473 TATGTGTTGGGGTGTGTGTTGGG - Intergenic
949072840 2:242036407-242036429 CAGGTCCTGGGGTGAGTGTGTGG + Intergenic
1169131093 20:3166729-3166751 CAGGAGCTTGGGTGGGTGGCTGG + Exonic
1169178943 20:3544875-3544897 CATGTGCTGGGTTGTGAGTGAGG + Intronic
1169217090 20:3800222-3800244 CTGGTGCTGGGGTGGGTGATGGG + Intronic
1170765059 20:19282785-19282807 CTGTTGCTGGGGTGTGTTTTGGG + Intronic
1171251961 20:23655766-23655788 GGGGTGCGGGGGTGGGTGTCAGG - Intergenic
1171401575 20:24875941-24875963 CAGGGGCTGGGGTGGGTGTGAGG - Intergenic
1171414417 20:24967975-24967997 CTGTTGCTGGGCTGTGTGTCTGG - Intronic
1172145118 20:32752160-32752182 CAGGTCCTGTGTTGGGTGTCAGG + Intergenic
1172777480 20:37415939-37415961 CTTGTGTTGGGGTGTGTGTGTGG + Intergenic
1173648152 20:44646425-44646447 CAGCTGGTGGGTTTTGTGTCAGG + Intronic
1173743175 20:45416652-45416674 CAGGTGCAGAGCTGTGGGTCTGG + Exonic
1174301234 20:49584095-49584117 CAGGTGCTGGGCTGGGAGTTAGG - Intergenic
1174321054 20:49741950-49741972 CAGGGGCTGGGAGGCGTGTCAGG - Intergenic
1175295170 20:57903324-57903346 CAGGAGATGGGGTGTGTGCTAGG + Intergenic
1175912250 20:62410525-62410547 CAGGTGCTGGGCTGTGGGAGGGG + Exonic
1176426470 21:6551566-6551588 TAGGTGGTGGGGTGTGTGTGTGG - Intergenic
1177115309 21:17078393-17078415 TGGGTGCTGGGTAGTGTGTCAGG + Intergenic
1177355944 21:20007693-20007715 CAATTCCTGGGGTGTGTGTTGGG - Intergenic
1177820847 21:26029371-26029393 CAGGTGCTGAGGTCAGTGTCTGG - Intronic
1179064014 21:38007206-38007228 CAGGTAGTGGGGTGGTTGTCAGG + Intronic
1179556749 21:42183431-42183453 TATGTGGTGGGGTGTGTGTGTGG + Intergenic
1179701961 21:43159883-43159905 TAGGTGGTGGGGTGTGTGTGTGG - Intronic
1179801776 21:43814613-43814635 GAGGTGCTGGGGCCTGTGTGGGG + Intergenic
1180150581 21:45945174-45945196 GAGGCGCTGGGTTCTGTGTCTGG + Intergenic
1180184264 21:46131696-46131718 CAGGGCCTGGGGCCTGTGTCAGG + Intronic
1180840005 22:18954809-18954831 CTGGTGCTGGGGTGGGTGGCAGG - Intergenic
1181027369 22:20133804-20133826 CAGGAGATGGGGGGTGTGTGGGG - Intronic
1181061895 22:20285671-20285693 CTGGTGCTGGGGTGGGTGGCAGG + Intergenic
1181804060 22:25364589-25364611 CAGGTGCAGGGGACTGTGTTGGG + Intronic
1183314420 22:37129062-37129084 CCTGTGCTGGGCTGTGGGTCAGG - Intronic
1183606330 22:38868586-38868608 CAGAGGCTGGGGTGTGTGTGGGG + Intronic
1184730889 22:46370421-46370443 CAGTTTCGGGGGTGTGTGTGTGG - Intronic
1184869110 22:47222318-47222340 CAGGTACTGGGCTGTGTCTCCGG - Intergenic
1184974333 22:48050408-48050430 CAGAGGCTGGGGTGAGGGTCAGG + Intergenic
1185284273 22:49993397-49993419 CAGGTGTGGGGGTGGGTTTCCGG + Intergenic
1185393109 22:50573223-50573245 GAGGTGTTGGGGTGCGTGCCAGG + Intronic
949309977 3:2686407-2686429 GAGGAGATGGGGTGTGTGTCGGG - Intronic
949510854 3:4765470-4765492 CAGGCATTGGGGTGTGTGTATGG + Intronic
949515647 3:4804604-4804626 CAGGATCTGGGGTGTGTTTGAGG + Intronic
949663047 3:6303880-6303902 TTGGTGCTGGGGCTTGTGTCTGG + Intergenic
950124635 3:10503972-10503994 CAGGTGCTGGGGTGTGGGCATGG + Intronic
950850632 3:16059172-16059194 CAAGTGCTGGGAAGAGTGTCTGG + Intergenic
954610970 3:51944329-51944351 CATTTGCTGGCCTGTGTGTCGGG - Intronic
954943141 3:54393394-54393416 CCACTGCTGGAGTGTGTGTCTGG + Intronic
955977343 3:64491090-64491112 CAGGTGCTGGGGTATGGGGCTGG + Intergenic
956959114 3:74376689-74376711 CATGGACTGGGGTGGGTGTCAGG - Intronic
957051911 3:75417950-75417972 CAGGTGCAGGGCTATGTGTCAGG + Intergenic
957672983 3:83329106-83329128 CAGGTCCTGTGTTATGTGTCTGG - Intergenic
958432676 3:94060728-94060750 CAGGTGCTGGGGACTCAGTCGGG + Exonic
959619618 3:108385906-108385928 AAGGTGGTGGTGTGTGTGGCGGG - Intronic
960158758 3:114326000-114326022 CAGGTGCAGGGGTGTGGGGAAGG + Intergenic
961635852 3:128331801-128331823 CAGGTGCTGGGGAGGGTGTGGGG + Intronic
962391457 3:134976125-134976147 CAAGAGCAGGGGTGTGTGTGTGG - Intronic
964254938 3:154765851-154765873 CAGGTGCTGGTATGGGTGCCAGG + Intergenic
964444700 3:156746603-156746625 CAGGTGCTGAGGTGCTTGTGAGG - Intergenic
966340636 3:178922070-178922092 CAGGTTTTGGGGTCTGTGTTAGG - Intergenic
967828481 3:193898008-193898030 GAGGTGCTGGGGTGGGCGGCTGG + Intergenic
968288594 3:197522331-197522353 CAGGAGCTGGGTTGGGTGCCAGG - Intronic
968652056 4:1764023-1764045 CAGGGGCTGGGCTGGGTGCCAGG + Intergenic
969216834 4:5729911-5729933 CAGGTGTTGGGGTCTGACTCTGG - Intronic
969377459 4:6772183-6772205 CTGGTGCTGGGGCCTGTGACGGG - Intergenic
969496697 4:7530317-7530339 CAGGTGCTGGGGTCTGAGGCAGG + Intronic
969498094 4:7537490-7537512 TAGGTGCTGGGCTGTGTGCTTGG + Intronic
969683041 4:8653653-8653675 CAGGTGGTGGGGGGTGTGACGGG + Intergenic
969747573 4:9086017-9086039 CAGGTGCTGGAGAGTATGTGGGG + Intergenic
969819248 4:9707948-9707970 CAGGTACAGGGCTGTGCGTCAGG - Intergenic
975696786 4:77021606-77021628 CAGGTGGTGTGAGGTGTGTCTGG + Intronic
977921051 4:102642829-102642851 CAGGGGTTGGGGTGTGTTTCTGG - Intronic
978971060 4:114807148-114807170 CAGGTTCTAGGGTGTGTTTATGG - Intergenic
981054278 4:140344306-140344328 CAAGTCCTTGGGTGTGTGTGGGG + Intronic
981054802 4:140349780-140349802 CAGGTGCTGTGGTTTGTGTTGGG - Intronic
985565127 5:611868-611890 CGGGTGCTGGGGTGTCTGGAGGG + Intergenic
985631833 5:1017921-1017943 GTGGTGCTGGGGTGTGGGACAGG + Intronic
986038102 5:3960174-3960196 CAGGTGCTGGGAAATGTGTTTGG + Intergenic
989983868 5:50673153-50673175 CAGGAGCTGGGGTGGCTGTGGGG + Intronic
993049815 5:82913187-82913209 CATGAGCTTGTGTGTGTGTCTGG + Intergenic
994296149 5:98090652-98090674 CAGGTGTTGGGGTGGTTGGCTGG - Intergenic
995404489 5:111779338-111779360 CAGGTGCAGAGCTGTGTGACAGG - Intronic
996771688 5:127093180-127093202 CAGGTATTGGTGTTTGTGTCTGG - Intergenic
997358894 5:133281824-133281846 CAGGTCATGGGGTTTGGGTCAGG + Intronic
997690215 5:135823136-135823158 CAGGGGCTAGGGTGGGAGTCGGG + Intergenic
998128223 5:139638167-139638189 CCCGTGCTCGGGTGTGTGTTTGG - Intergenic
998157510 5:139795330-139795352 CGGGGGCTGGCGTGTGTGTCGGG + Intergenic
1000178510 5:158783636-158783658 CAGGTTCTGTGGTCTGAGTCTGG - Intronic
1000420659 5:161034939-161034961 CAGGGGCTGAGGTGGGGGTCAGG - Intergenic
1000690801 5:164317910-164317932 CAGGTTTAGGGGTGTGTGTGCGG - Intergenic
1001633976 5:173196734-173196756 CAGGTGCTCAGCAGTGTGTCTGG + Intergenic
1001667971 5:173449132-173449154 GAAGTGCTGGTGTGTGTGTGTGG + Intergenic
1002458407 5:179359555-179359577 GTGTTGCTGGGGTGTGTGTGAGG - Intergenic
1005039417 6:21587941-21587963 CAGGTGCTGGGGACTGAATCTGG + Intergenic
1005821712 6:29604474-29604496 GAGGTGCGGGGGTGGGTGTCAGG - Exonic
1005898082 6:30195445-30195467 CAGGCCATGGGGTGGGTGTCAGG - Intronic
1006053879 6:31366121-31366143 CAGGTGCTGGGGACTCAGTCAGG + Intergenic
1006068188 6:31477648-31477670 CATGTGCTGGGATTTGTGCCTGG - Intergenic
1006295223 6:33167252-33167274 CAGGTCCTGTGGTGAGTGACTGG - Exonic
1007719988 6:43879199-43879221 CTGGGGCTGGGGTGTGTGTAGGG - Intergenic
1009462863 6:63934970-63934992 GAGGTGCGGGGCTGTGTTTCTGG - Intronic
1009752342 6:67888710-67888732 GAGGTCCTGGGTTGTGTGGCTGG + Intergenic
1010196576 6:73245752-73245774 TGGGTGGTGGGGGGTGTGTCTGG - Intronic
1011622487 6:89256050-89256072 CAGGTGTGGTGGTGTGTGCCTGG - Intergenic
1013012452 6:106132880-106132902 GCGCTGCTGGAGTGTGTGTCTGG - Intergenic
1013244969 6:108277629-108277651 TAGGTGCTAGGGTGGGTGTGGGG + Intergenic
1014194642 6:118540285-118540307 CAGGTGCTGTGCTGAGTATCAGG - Intronic
1014632316 6:123803089-123803111 CAGGTGCTGGGCGGTGCGTCCGG + Intergenic
1016702333 6:147067614-147067636 CTGGTGATGGGGAGTGGGTCAGG + Intergenic
1016748826 6:147610702-147610724 CAGTTGCTCTGGTGAGTGTCTGG + Intronic
1017884174 6:158585415-158585437 CATGTGCAGGGGTGAGTGTGTGG + Exonic
1017970923 6:159312038-159312060 CAGCAGCCGGGGTGTGGGTCAGG + Intergenic
1018339610 6:162837748-162837770 CATGTGCTGAGGTGTATGACTGG - Intronic
1018608569 6:165624232-165624254 CAGATGCTGGAGAGTGTGCCAGG - Intronic
1018788543 6:167128235-167128257 CAGGTTCTGGTGCCTGTGTCAGG + Intronic
1019273697 7:164810-164832 CAGGTGCTCGGGTGTGGAGCTGG - Intergenic
1019376161 7:693407-693429 CGGGGGCTGGGGCGGGTGTCGGG - Intronic
1019711679 7:2520824-2520846 CAGGTTTTGGGGTCTGTGTGGGG + Intronic
1019763880 7:2835238-2835260 CTGGTGGTGGGGTGTGCCTCAGG - Intronic
1019993173 7:4706590-4706612 CAGCTGGTGGGGTGGGTGTCAGG - Intronic
1020155550 7:5720995-5721017 CTGGTCTTGGGGTGTGTTTCTGG - Intronic
1020318977 7:6926648-6926670 CAAGTGCAGGGCTGTGCGTCAGG + Intergenic
1021576375 7:22109422-22109444 GAGGTGCTGCGGTGAGTGACAGG - Intergenic
1022106649 7:27201671-27201693 CAGATGGTGGGGTGTGTGTGAGG - Intergenic
1022360109 7:29649455-29649477 CAGGCGCTGGGGAGGGTGTGGGG + Intergenic
1022936776 7:35186357-35186379 CAGGCGCTGGGGAGGGTGTTGGG - Intergenic
1023346017 7:39271970-39271992 GAGGAGTTGGGGTGTGTGTGTGG + Intronic
1023994918 7:45153582-45153604 GAGGTGATGGTGTGTGTGTGTGG - Intergenic
1024261558 7:47577494-47577516 CAGGGGCTGGGCTGTGGGTGGGG + Intronic
1024355622 7:48410914-48410936 CAGGAGCTGCTGTGAGTGTCAGG + Intronic
1024944699 7:54797010-54797032 CAGGTGCTGGGCTATATCTCAGG + Intergenic
1026584268 7:71643485-71643507 AAAATGCTGGGGTGTGTGGCTGG - Intronic
1027353976 7:77338915-77338937 GAGGGGCGGGGGTGTGTGTGTGG - Intronic
1028484660 7:91344473-91344495 CAGGTGCTCGGCTGAGTGTGAGG - Intergenic
1028898988 7:96075290-96075312 TGGGTGTTGGGGTGTGTGTGTGG - Intronic
1028993729 7:97076912-97076934 ATGGTGCTGGGGTGTGTGGAGGG + Intergenic
1029436862 7:100568505-100568527 CAGGTGGTGTGGTGTGGGGCGGG - Intergenic
1029598279 7:101549099-101549121 CAGGTGCTGGGGTGGGAGGCTGG + Intronic
1029736173 7:102467150-102467172 TTGTTGCTGGGGTGTGTGTGGGG + Intronic
1029833012 7:103280457-103280479 CAGGCGCTGGGGAGGGTGTGGGG - Intergenic
1030110152 7:106020028-106020050 CAGGTGCATGTGTGTGTGTGTGG + Intronic
1031483030 7:122300592-122300614 ACGGTGCTGGGCTGTTTGTCTGG + Intergenic
1032092580 7:128918517-128918539 GGGGTGCTGGGGTGTGGGACTGG - Intergenic
1032401924 7:131629716-131629738 CAGGTCTTGGGGTGTGGGTGGGG + Intergenic
1032723802 7:134572484-134572506 CAGGTGTGGTGGTGTGTGCCTGG + Intronic
1034358859 7:150476771-150476793 CAGGTGCCAGGGAGTCTGTCTGG + Intronic
1034445180 7:151110453-151110475 CGGGTCCTGGGGAGGGTGTCAGG + Intronic
1034524663 7:151649983-151650005 CACATACAGGGGTGTGTGTCGGG - Intronic
1034716905 7:153251839-153251861 GTGGTGCTGGGGGGTGTGCCTGG - Intergenic
1035032507 7:155870604-155870626 CAGGTGCTGTGTGGTGTTTCAGG - Intergenic
1035113524 7:156504657-156504679 GAGGTGCTGGGTGGTGTGTTTGG - Intergenic
1035248499 7:157581051-157581073 CAGGTGCTGGGGTGTGCAGGGGG - Intronic
1035293588 7:157855039-157855061 CTGTTGCAGGGGTGTGTGTGGGG + Intronic
1035621152 8:1036535-1036557 CAGGTGCTGGTGAGAGTGTTGGG + Intergenic
1036762110 8:11516586-11516608 CAGGGGCTGGGGGCTGGGTCGGG - Intronic
1038658482 8:29475771-29475793 CAGGTGCTGTGGTGTGTCCCTGG + Intergenic
1038789917 8:30658872-30658894 CAGGTGCTGGTGTGTGGCGCTGG - Intergenic
1042228101 8:66530602-66530624 CTGGTGTTTGGGTGGGTGTCAGG - Intergenic
1043259429 8:78178793-78178815 CAGATGTTGTGGTGTGTGCCTGG + Intergenic
1045189192 8:99866393-99866415 GAGGTGTTGGTGTGTGTGACAGG + Intronic
1045299469 8:100898851-100898873 CAGCTGCTGGGGAGTGTTTCTGG - Intergenic
1045322648 8:101093529-101093551 CAGCTCAGGGGGTGTGTGTCAGG - Intergenic
1045655741 8:104384601-104384623 CATATGCTGGGGTCTGTGTCAGG - Intronic
1046075098 8:109304167-109304189 GAAGTGCAGGGGTGTGTGACTGG + Intronic
1046086462 8:109443060-109443082 CAGGTGCAAGGGAATGTGTCTGG - Exonic
1047543837 8:125796848-125796870 AAGTTGCGGGTGTGTGTGTCAGG + Intergenic
1047622291 8:126620287-126620309 AAGGCTCTGGGCTGTGTGTCAGG + Intergenic
1049178166 8:141206594-141206616 CAGCTGCTGGGGTTTGAATCCGG - Intergenic
1049278099 8:141730031-141730053 CAGGCACTGGGGTGTGTGCCTGG - Intergenic
1049335529 8:142082588-142082610 CTGTGTCTGGGGTGTGTGTCTGG - Intergenic
1049335625 8:142083118-142083140 CTGTGTCTGGGGTGTGTGTCTGG - Intergenic
1049357301 8:142195215-142195237 CAGGGGGTGGGGTGGGGGTCAGG - Intergenic
1049384087 8:142332105-142332127 CAGCAGCTGGCGTGTGTGCCCGG + Intronic
1049385902 8:142342865-142342887 CAGGTGCTGGGACAGGTGTCCGG - Intronic
1049420986 8:142516551-142516573 CAGGTGCATGTGTGTGTGTGTGG + Intronic
1049551450 8:143261801-143261823 CAGGTGCAGGGGTGCGGGTGGGG - Intronic
1049551467 8:143261850-143261872 CAGGTGCAGGGGTGCGGGTGCGG - Intronic
1049551501 8:143261974-143261996 CAGGTGCAGGGGTGCGGGTGCGG - Intronic
1049749378 8:144276144-144276166 CAGGTGCTGGGGGTTGGGGCTGG - Intronic
1049787012 8:144455892-144455914 CAGGAGCTGGGGTGGCTTTCGGG - Intronic
1050061982 9:1718972-1718994 AAGGTTCAGGTGTGTGTGTCAGG - Intergenic
1053009483 9:34625007-34625029 GAGGTGCTGGGGTGAGGGCCGGG + Intronic
1054902435 9:70383412-70383434 GAAGTGCTGGGGTGGTTGTCAGG - Intergenic
1055404720 9:75962562-75962584 GTGGTGCTGGAGTGTGTGCCTGG + Intronic
1055550730 9:77429932-77429954 CAGGGACTGGTGTGTGTGTGTGG - Intronic
1056120484 9:83483013-83483035 CTGGTTCTGGGGTGTGGGTTTGG + Intronic
1056132916 9:83603077-83603099 AAGGCCCTGGGGTGTGTGTGCGG - Intergenic
1056978846 9:91288168-91288190 GAGGTTTTGGGGTCTGTGTCAGG - Intronic
1057194480 9:93109247-93109269 CAGGAGCTGTGGTGTCTGTGAGG - Intronic
1058013499 9:100004147-100004169 CAGGTGCTGGCCTGGGGGTCAGG + Intronic
1058831231 9:108818648-108818670 CACTTCCTGGGGTGTGTGTGTGG - Intergenic
1059429512 9:114241423-114241445 AAGGAGCTGGGGGGTGTCTCTGG + Intronic
1061046674 9:128169032-128169054 CAGGTGCTGGGGGGAGGGTGTGG - Exonic
1061516182 9:131091802-131091824 CAGGTGGGGGAGTGTGTGCCGGG - Exonic
1061939035 9:133874299-133874321 GAGGGGCTGGGGAGTGTCTCTGG - Intronic
1062032061 9:134366198-134366220 CATGTTCTGGGCTGTGTGTGGGG + Intronic
1062119522 9:134826805-134826827 CAGGTGTGTGGGTGTGTGGCTGG + Intronic
1062318187 9:135978338-135978360 AAGGTTCTGGGGGGTGTGCCAGG - Intergenic
1062431066 9:136527079-136527101 CAGGTGTGGGGGTCTGTGTGTGG + Intronic
1062511316 9:136907711-136907733 TAGGAGCTGGTGTGTGTGGCAGG + Intronic
1185579430 X:1198600-1198622 CAGTCGCTTGGGTATGTGTCTGG + Exonic
1185868209 X:3641220-3641242 CCTGTGCTGGGGTGTGGGTCGGG + Intronic
1185883588 X:3761825-3761847 CAGATTCTGGGGTGTGTGTGTGG - Intergenic
1188499273 X:30807854-30807876 CAGTTGCTGCGGTGTGTGAGGGG - Intergenic
1189006225 X:36998492-36998514 CAGGTGTTTGGGTGTGTCACAGG + Intergenic
1189042367 X:37555313-37555335 CAGGTGTTTGGGTGTGTCACAGG - Intronic
1189158013 X:38779806-38779828 CAGGGGCTGGGGTGGTTGACAGG - Intergenic
1189239987 X:39517475-39517497 CAGGTGGTTGGGTGTGTCTAGGG - Intergenic
1189273208 X:39766327-39766349 AATGTGCTGGGGTGTGGGTGGGG - Intergenic
1190090194 X:47430575-47430597 CAGGTGTGGTGGTGTGCGTCTGG + Intergenic
1190458437 X:50646873-50646895 CAAATGCTGTGGTGTGTGTCAGG + Intronic
1192316505 X:70055894-70055916 TAGGTGTTGGAGTGTGAGTCAGG - Intergenic
1193599600 X:83493970-83493992 CAGGTGCTGGGGACAGTTTCAGG - Intergenic
1194257978 X:91657746-91657768 TAGGTTCAGGGGTGTGTGTGGGG - Intergenic
1195413142 X:104590662-104590684 GAGGTGCTGGGCTATGGGTCAGG + Intronic
1196368983 X:114954172-114954194 CAGCTGCTGTGGGGTGTGTTGGG + Intergenic
1199147311 X:144383486-144383508 CAGGTGCTACAGTGGGTGTCAGG + Intergenic
1200140650 X:153901228-153901250 CAGGTGCTGGGGTGAGGGGCGGG - Intronic
1200576743 Y:4897248-4897270 TAGGTTCAGGGGTGTGTGTGGGG - Intergenic
1200781839 Y:7223745-7223767 CAGATTCTGGGGTGTGTGTGTGG + Intergenic