ID: 1072638881

View in Genome Browser
Species Human (GRCh38)
Location 10:97196231-97196253
Sequence CCGACGCCGCGGGCCGGGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 463
Summary {0: 1, 1: 0, 2: 3, 3: 41, 4: 418}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1072638881_1072638893 5 Left 1072638881 10:97196231-97196253 CCAGCCCCGGCCCGCGGCGTCGG 0: 1
1: 0
2: 3
3: 41
4: 418
Right 1072638893 10:97196259-97196281 CGGCGCGGAACCCGGAGTGCCGG No data
1072638881_1072638892 -3 Left 1072638881 10:97196231-97196253 CCAGCCCCGGCCCGCGGCGTCGG 0: 1
1: 0
2: 3
3: 41
4: 418
Right 1072638892 10:97196251-97196273 CGGGGCAGCGGCGCGGAACCCGG No data
1072638881_1072638900 24 Left 1072638881 10:97196231-97196253 CCAGCCCCGGCCCGCGGCGTCGG 0: 1
1: 0
2: 3
3: 41
4: 418
Right 1072638900 10:97196278-97196300 CCGGCTGGGTTCGCGGACACTGG No data
1072638881_1072638891 -10 Left 1072638881 10:97196231-97196253 CCAGCCCCGGCCCGCGGCGTCGG 0: 1
1: 0
2: 3
3: 41
4: 418
Right 1072638891 10:97196244-97196266 GCGGCGTCGGGGCAGCGGCGCGG No data
1072638881_1072638894 9 Left 1072638881 10:97196231-97196253 CCAGCCCCGGCCCGCGGCGTCGG 0: 1
1: 0
2: 3
3: 41
4: 418
Right 1072638894 10:97196263-97196285 GCGGAACCCGGAGTGCCGGCTGG No data
1072638881_1072638898 17 Left 1072638881 10:97196231-97196253 CCAGCCCCGGCCCGCGGCGTCGG 0: 1
1: 0
2: 3
3: 41
4: 418
Right 1072638898 10:97196271-97196293 CGGAGTGCCGGCTGGGTTCGCGG No data
1072638881_1072638895 10 Left 1072638881 10:97196231-97196253 CCAGCCCCGGCCCGCGGCGTCGG 0: 1
1: 0
2: 3
3: 41
4: 418
Right 1072638895 10:97196264-97196286 CGGAACCCGGAGTGCCGGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1072638881 Original CRISPR CCGACGCCGCGGGCCGGGGC TGG (reversed) Intronic
900105624 1:979653-979675 CCGACGCCGCTGGCCTCGCCTGG - Exonic
900244274 1:1630319-1630341 CTGGCGCGGCGGGCCGGGGGCGG - Exonic
900305328 1:2003919-2003941 CCGACCGCGCGGGCCGGGGCCGG + Intergenic
900514202 1:3073638-3073660 CAGACGGCGTGGGCCGGGTCGGG + Intronic
900630647 1:3633424-3633446 CCGCCGCCCCGGGCCGGGGCCGG - Exonic
900633957 1:3652669-3652691 TCGGCTCCGCGGGCGGGGGCTGG + Intronic
901049677 1:6419965-6419987 CGGACTCCGCGGGGCGGGGCGGG - Intronic
901050717 1:6424700-6424722 CGGAGGCTGCGGGGCGGGGCGGG + Intergenic
901425941 1:9182502-9182524 CCGCCGCCGCCCGCCTGGGCTGG + Intergenic
902385585 1:16073673-16073695 GCGACACCGCGGGGCGCGGCGGG + Intergenic
902757535 1:18558676-18558698 CGGGCGCCGGGGGCGGGGGCGGG + Intergenic
903324732 1:22563440-22563462 CCGCCGCCCCGGGCGGGGGCCGG - Intergenic
903324737 1:22563446-22563468 CCGCCGCCGCCGCCCCGGGCGGG - Intergenic
903603029 1:24556056-24556078 GGGACGCCCCGGGCGGGGGCGGG + Intergenic
904143247 1:28369958-28369980 CCGTCGCTTCGGGCCAGGGCGGG + Intronic
904642009 1:31938134-31938156 CCGCCGCCGCCGGGCCGGGCCGG - Exonic
905393216 1:37651248-37651270 CCGACTCTGTGGGCCTGGGCTGG - Intergenic
906637007 1:47416479-47416501 CCGCCGCCCCGGGCCGGGCGCGG - Exonic
906637011 1:47416485-47416507 CCGCCGCCGCCGCCCCGGGCCGG - Exonic
907185037 1:52602737-52602759 ACGTAGCCGCGGGCCGGGCCGGG - Intronic
908195546 1:61742871-61742893 CCGAGGCCGCGGGCAGGGAGGGG + Intronic
908477763 1:64505856-64505878 CCGGCGGGGCGGGGCGGGGCGGG - Intronic
909928892 1:81472384-81472406 GCGAGGCCGAGGGCCGAGGCAGG + Intronic
909957914 1:81801679-81801701 CCGACCCTGCGGCCTGGGGCGGG - Intronic
910221495 1:84893252-84893274 CCGGCGGGGCGGGGCGGGGCAGG - Intergenic
910892207 1:92029961-92029983 CGGCCGCCCCGGGCCGGGGGAGG + Exonic
912337535 1:108876889-108876911 GCGGCGCAGCGGGGCGGGGCGGG - Exonic
912515012 1:110211696-110211718 CCGACCCCGACGGCGGGGGCCGG + Exonic
912539959 1:110407415-110407437 CCAAGGCCGCAGGGCGGGGCGGG - Intronic
914490009 1:148146137-148146159 CCGGGGGCGCGGGCCGGGGTGGG + Intronic
915213355 1:154325636-154325658 CCCATGCCGGGGGCTGGGGCGGG - Intronic
915246288 1:154558465-154558487 GCGGCGCCGGGGGCCGGGGGCGG - Exonic
919463236 1:197902930-197902952 CGGCCGCGGCGGGGCGGGGCGGG - Intronic
919929917 1:202214418-202214440 CGGGCGGCGCGGGCAGGGGCGGG + Intronic
920139365 1:203796390-203796412 CCGACGCTGAGGGCCAGGGGTGG - Exonic
920394180 1:205631850-205631872 CCGCTGCCGCGTGCGGGGGCGGG - Exonic
921172050 1:212558811-212558833 CCCACCCCTCGGGCCGGGCCCGG + Intergenic
922648613 1:227318111-227318133 CCGGCGCGGCGGCCCGGTGCGGG - Exonic
923056089 1:230426463-230426485 CCTCCTCCGCGGGGCGGGGCGGG + Intergenic
923191774 1:231626895-231626917 CCGCCGCCGCCGGCGGCGGCTGG - Exonic
924561086 1:245156579-245156601 CAGACGCCGCGGTCCGAGCCGGG - Exonic
924741594 1:246797325-246797347 CCGAAGCCTGGGGCCGGGGGTGG - Intergenic
1063417952 10:5889351-5889373 CCATCGCCGCGGGTCGGGCCGGG + Exonic
1064208967 10:13347771-13347793 CCGCCGCCGCCGCGCGGGGCCGG - Intronic
1065025314 10:21534890-21534912 CCGCGGCCGCGGCACGGGGCGGG - Intronic
1065025368 10:21535060-21535082 CTGACTCGGCGGGGCGGGGCGGG + Intronic
1065883710 10:30059166-30059188 CGGGCACCGCGGGCCGCGGCTGG - Intronic
1066022567 10:31318827-31318849 CCGCCGCGGCTGCCCGGGGCAGG - Intronic
1067060923 10:43077522-43077544 CGGGCGCCTCGGGCCGGGGCTGG + Intronic
1067096545 10:43305063-43305085 CCGATCCCGGGGGCGGGGGCGGG - Intergenic
1069456896 10:68560790-68560812 CCGACGCCGAGGCCCGAGGGGGG + Intronic
1072107766 10:92290801-92290823 CCGACGCCACGGCCGGGGCCGGG + Intronic
1072151718 10:92689781-92689803 CCGGCGGGGCGGGCCGGGGTGGG + Intergenic
1072638881 10:97196231-97196253 CCGACGCCGCGGGCCGGGGCTGG - Intronic
1073147949 10:101292600-101292622 GCGCGGCCGCGGGCCGGAGCGGG - Intergenic
1075501731 10:122980716-122980738 CCTGGGCCGCGGGGCGGGGCGGG + Intronic
1077404650 11:2377622-2377644 GCTGCGCCGGGGGCCGGGGCGGG + Intronic
1078561570 11:12377574-12377596 CGGACGCAGCGGGCGGCGGCGGG - Exonic
1083289223 11:61680518-61680540 CCGGCGCGGCGGGCCGGTCCTGG + Intronic
1083335142 11:61917660-61917682 CCGGCGCGGCGGGCCGGGTGGGG - Intronic
1083554438 11:63614468-63614490 CCGGCGGCGCGGGGAGGGGCCGG - Intronic
1083657040 11:64234718-64234740 CGGGCGCGGCGGGCGGGGGCCGG - Exonic
1083660909 11:64251441-64251463 CCGACGCGGTGGGAGGGGGCGGG + Intergenic
1083753669 11:64777989-64778011 CCTCCGCCGCCGGCCGGGCCCGG + Exonic
1083842878 11:65314819-65314841 TTGGCTCCGCGGGCCGGGGCGGG + Exonic
1084171228 11:67401883-67401905 GCGGGGCCGCGGGCCGGGGGCGG - Intronic
1084758378 11:71252733-71252755 CCGCAGCCGCGGGCGGGAGCGGG - Intergenic
1085312671 11:75525617-75525639 CCGGCGCAGCGGGTCAGGGCCGG + Exonic
1087076210 11:94129089-94129111 CCGGCGGGGCGGGGCGGGGCGGG - Exonic
1089533855 11:119149219-119149241 CCGGCGGCCCGGGCCGGGGCGGG - Exonic
1089678860 11:120108322-120108344 CTGACGGCCCGGGCTGGGGCAGG + Intergenic
1091354250 11:134923536-134923558 CCGACTTAGCGGGCAGGGGCTGG + Intergenic
1091616195 12:2052906-2052928 CGGGCGGCGCGGGCAGGGGCGGG + Intronic
1091730395 12:2876666-2876688 CCGAGGCCGCGGGCAGGGTGCGG + Intronic
1091740764 12:2959256-2959278 CCGCCGGGGCGGGGCGGGGCCGG - Intergenic
1092196750 12:6554515-6554537 GCGAGGCCGCGGGGCGGGCCCGG - Intronic
1092196925 12:6555402-6555424 CCGCCGGCTCGGGCCGGGACTGG - Exonic
1095971683 12:47905730-47905752 CCGATGCCACGGGGCGGGGGGGG - Intronic
1096466190 12:51848693-51848715 CGGCCGCCGCGGGCGGGAGCGGG + Intergenic
1096491369 12:52014915-52014937 CCGAAGGCGCGGGCCGGGGGCGG - Exonic
1096747855 12:53739952-53739974 CCGAGGGCGAGGGCGGGGGCGGG + Intergenic
1096747868 12:53739977-53739999 CCGAGGGCGAGGGCGGGGGCGGG + Intergenic
1096749844 12:53751729-53751751 CGGAAGCCGCGGCCCCGGGCGGG - Intergenic
1096796739 12:54082567-54082589 CCGGGGCCGGGGGCCGGGGCCGG + Intergenic
1097190374 12:57216737-57216759 CTGACTCCGCGGGCGGGGGGCGG - Intergenic
1100444825 12:94650590-94650612 CCGCCGCCGCGGGGTGGGGGAGG + Intergenic
1100619415 12:96256822-96256844 AGGAGGCAGCGGGCCGGGGCAGG + Intronic
1103604887 12:122079028-122079050 CCGCCGCCTCGGGCCGGGCCGGG + Exonic
1103649643 12:122422639-122422661 CCGCCGCCGCGGGGCCGGGCGGG + Intergenic
1103899237 12:124295014-124295036 CCCACCGCGCAGGCCGGGGCGGG + Intronic
1104049631 12:125186729-125186751 CGGGAGCCGCGGGCCGGGCCGGG + Intergenic
1104642550 12:130476627-130476649 ACCACGCCGAGGGCTGGGGCAGG - Intronic
1104854315 12:131894919-131894941 GCGGAGGCGCGGGCCGGGGCGGG - Exonic
1105031409 12:132887159-132887181 CCGGGGCCGGGGGCCGGGGCCGG - Intronic
1107468024 13:40666647-40666669 GCGCCGCCGCGGGCGGGGGGCGG - Intergenic
1108373347 13:49792290-49792312 CCGTCACCGCGGCCCCGGGCTGG - Intronic
1108373371 13:49792372-49792394 CCGGCGACGCGGGGAGGGGCGGG - Intronic
1108518186 13:51222274-51222296 CGGACGGCGAGGGGCGGGGCGGG + Intergenic
1112271903 13:97976480-97976502 CCGGCGCCGGCGGCCGCGGCGGG + Intronic
1113956026 13:114100204-114100226 TCAGCACCGCGGGCCGGGGCGGG - Intronic
1113967701 13:114163775-114163797 CCCAGGCCGAGGGCAGGGGCAGG + Intergenic
1113985845 13:114314802-114314824 CCGCCCCCACAGGCCGGGGCGGG + Intronic
1116018352 14:39432557-39432579 CGCAGGCCGCGGGGCGGGGCGGG + Intergenic
1117690395 14:58299351-58299373 CCGCCACCGCGGGCCCGGGGCGG + Intronic
1118024075 14:61751198-61751220 CCGGGGCCGCGGGCGGGGCCCGG - Intergenic
1119539970 14:75431598-75431620 CCGAGGCCGAGGGCAGGTGCTGG + Intronic
1119731954 14:76956674-76956696 CGCCCGCCGCGGGCCGGGGCTGG + Intergenic
1120167847 14:81220233-81220255 GGGCCGCCGCGGGCCGGGCCGGG - Intronic
1120521849 14:85533773-85533795 TCCCCGCAGCGGGCCGGGGCCGG - Intronic
1120809853 14:88792526-88792548 TCGCCGCCGCGGGCCCGAGCGGG - Exonic
1122075227 14:99231315-99231337 ACGACGCCGCGGTGGGGGGCGGG - Intronic
1122131069 14:99604698-99604720 CCGGGGACGCGGGCCGGGGAGGG - Intergenic
1122221139 14:100239650-100239672 TCGTCGCCGCCGGCCGGCGCGGG - Exonic
1122436636 14:101705749-101705771 AGGACCCTGCGGGCCGGGGCTGG + Intergenic
1122582021 14:102777234-102777256 GCGGCGCCGCGGCGCGGGGCGGG - Intergenic
1122707424 14:103629730-103629752 GCGGCGCCGGGAGCCGGGGCTGG - Intronic
1123036900 14:105475232-105475254 CGGACGGCGCCGGGCGGGGCGGG + Intronic
1123493237 15:20799486-20799508 AGGACACCGCGGGGCGGGGCAGG - Intergenic
1123549744 15:21368588-21368610 AGGACACCGCGGGGCGGGGCAGG - Intergenic
1124129453 15:26971412-26971434 CCGAGGCTGCTGGCCGCGGCGGG - Exonic
1124612073 15:31215756-31215778 CCGCCGCCCCGAGCCGTGGCCGG + Intergenic
1124629475 15:31328259-31328281 CGCCCGCCGCGCGCCGGGGCCGG - Intronic
1125685139 15:41559370-41559392 CCGCCGCCGCAGGTAGGGGCTGG + Exonic
1126777607 15:52112808-52112830 CGGGGGCCGGGGGCCGGGGCGGG - Intergenic
1127433287 15:58933199-58933221 CCCGCGCCCCGGGCCGGGCCGGG - Intronic
1128067885 15:64775653-64775675 CCGGCGGCGGGGGGCGGGGCCGG + Intergenic
1128199268 15:65791525-65791547 CCGTGCCCGCGGGCCGGGGAAGG + Intronic
1129082352 15:73052306-73052328 CGGACGGCGGGGGCGGGGGCGGG - Intronic
1129644700 15:77419730-77419752 CCGCCGCCGAGGGAGGGGGCAGG + Intronic
1131888622 15:96947920-96947942 CCGAGGACGCGGGCCGGCGCGGG - Intergenic
1132099806 15:99015206-99015228 CCGAGGCCGGGCGCCGAGGCCGG - Intergenic
1202958075 15_KI270727v1_random:95806-95828 AGGACACCGCGGGGCGGGGCAGG - Intergenic
1132480648 16:164841-164863 CCGGCGGGGCGGGGCGGGGCGGG + Intronic
1132480845 16:165442-165464 GAGACGCCGCGGGCCGGCCCGGG - Intronic
1132512590 16:352012-352034 CCGAGGCCGCGTGCCGGGTCCGG - Intronic
1132512953 16:353059-353081 CCTCCGGCGCGGGGCGGGGCCGG + Intergenic
1132869371 16:2108897-2108919 CACACGCCGGGGGCTGGGGCTGG + Exonic
1132915749 16:2342135-2342157 GCAACGCCCCGGGCCGGGGGCGG + Intergenic
1133259426 16:4538560-4538582 CAGGCGCCGCGGGCGGGGGCGGG + Intronic
1134070037 16:11255321-11255343 GTGTCGCCGGGGGCCGGGGCCGG + Exonic
1136519457 16:30786705-30786727 GGGACCCCGGGGGCCGGGGCAGG - Intronic
1136891515 16:33975567-33975589 CAGCCGCCGCGGGCCCCGGCCGG + Intergenic
1137926517 16:52546737-52546759 CCGGGGCCGGGGGCCGGGACTGG + Exonic
1138360755 16:56425447-56425469 CCGCCGCGCCGGGCCGGGCCGGG + Exonic
1138619137 16:58197880-58197902 CCGCCCCCGCGGGCCCGGCCTGG - Exonic
1139364837 16:66427053-66427075 CCGCCGAGGGGGGCCGGGGCCGG + Intergenic
1139475081 16:67199070-67199092 CCGCCTCGGCGGGGCGGGGCAGG + Intergenic
1140886842 16:79251744-79251766 CCAACGCTGGGGGCCTGGGCTGG + Intergenic
1141079230 16:81036011-81036033 TCGCCCCCGCGGGCCGCGGCCGG - Exonic
1141986303 16:87582567-87582589 CCGAGCCCGAGAGCCGGGGCAGG + Intergenic
1142211910 16:88812389-88812411 CGGAGGCGGCGGGCCTGGGCTGG + Intergenic
1203081517 16_KI270728v1_random:1148039-1148061 CAGCCGCCGCGGGCCCCGGCCGG - Intergenic
1142811791 17:2399012-2399034 CCGCCGCGGCGGGCGGGGGTGGG - Intronic
1143172824 17:4939882-4939904 GCGACGGCGAGTGCCGGGGCCGG - Exonic
1143575012 17:7787078-7787100 CGGAGGGCGTGGGCCGGGGCTGG + Intronic
1143676417 17:8436150-8436172 CCGCCGGGGCGGGCCGGGCCGGG + Intronic
1143904687 17:10198906-10198928 GCGAGGGGGCGGGCCGGGGCGGG + Intergenic
1144758642 17:17694816-17694838 GCGGGGCCGCGGGGCGGGGCGGG + Intronic
1145163090 17:20589077-20589099 CCCCCGCTGGGGGCCGGGGCCGG + Intergenic
1145190615 17:20840788-20840810 CCGGGGGCGCGGGCCGGGGTGGG + Intronic
1145266740 17:21383327-21383349 CCGAGGCAGAGGGTCGGGGCGGG - Intronic
1146208046 17:30921887-30921909 CTGACGGTGCGGGGCGGGGCTGG + Exonic
1146912565 17:36658048-36658070 CCAAGGCCCCGGGCCGGTGCGGG + Intergenic
1147393129 17:40122214-40122236 CCGGGGCGGGGGGCCGGGGCGGG + Intergenic
1147393325 17:40122817-40122839 CCGCCGCAGCCGGCCGGGGAAGG - Intronic
1148128306 17:45247942-45247964 CGGAAGCCGGGGCCCGGGGCTGG + Intergenic
1148167038 17:45490797-45490819 TTGGCACCGCGGGCCGGGGCAGG - Intergenic
1148652522 17:49260247-49260269 CAGACGTCGGGGGCGGGGGCCGG + Intergenic
1148836557 17:50468818-50468840 GGGACGCCTGGGGCCGGGGCTGG + Exonic
1149568103 17:57653485-57653507 CCGCCCCCGGGGCCCGGGGCTGG - Intronic
1150225566 17:63523016-63523038 CCTACGGGGCGGGGCGGGGCGGG - Intergenic
1150373670 17:64662381-64662403 CCGGCGGGGCGGGGCGGGGCCGG + Intergenic
1150747319 17:67825984-67826006 CCAGCGCCCCGGGCCGGGGGGGG + Exonic
1151438472 17:74113397-74113419 CCCACGGCGGGGGCGGGGGCGGG + Intergenic
1151453741 17:74214228-74214250 CCCACCCTGCAGGCCGGGGCTGG - Intronic
1151579971 17:74972273-74972295 GGGACGCCGCGGGGCGGGACAGG + Intronic
1151611938 17:75182333-75182355 CCGCCGCCGCGGCCCCAGGCAGG + Intergenic
1151662418 17:75525790-75525812 CCGAGGCCTCGGGCGGGGGCTGG + Exonic
1151683466 17:75633835-75633857 CCCACGCCGTGGGCTGGGCCTGG - Intronic
1151780363 17:76240966-76240988 CCGACGCTGAGGGGCGGGGTTGG - Intergenic
1151802075 17:76384613-76384635 CCGGCGCCGCGGAGCGGGGAGGG - Intronic
1152069801 17:78128834-78128856 GGGGCGCCGCGGGCCGGGCCGGG - Intronic
1152201223 17:78947540-78947562 CCAAAGCTGCGGGACGGGGCTGG + Intergenic
1152552197 17:81035397-81035419 CCGGGGCCGCGCGCCGGGCCAGG + Intronic
1152654836 17:81514674-81514696 ACGCCGCCGCGGGCCGGGGGTGG + Intronic
1152711207 17:81871217-81871239 CCGGCGGCGCCGGCGGGGGCGGG - Intronic
1152711218 17:81871242-81871264 CGGAGGCGGCGGGTCGGGGCGGG - Intronic
1154450789 18:14474023-14474045 AGGACACCGCGGGGCGGGGCAGG - Intergenic
1156099744 18:33578740-33578762 CCGCCGCCGCGGACCGGCGCGGG - Intronic
1158277095 18:55780401-55780423 CCGCGGCCGCGAGGCGGGGCTGG - Intergenic
1158427624 18:57353415-57353437 CAGACTCCGCGGGCCGGGCCCGG + Intronic
1158553911 18:58459649-58459671 CCCACGGCGGGGGCAGGGGCGGG - Intergenic
1159045623 18:63366827-63366849 GCGAGGCCGGGTGCCGGGGCCGG + Intronic
1159057075 18:63476870-63476892 CCGCCGAGGCGGGGCGGGGCGGG + Exonic
1159241731 18:65750905-65750927 CCGGCGCCCGAGGCCGGGGCAGG + Exonic
1159798071 18:72867694-72867716 GGGACGCCCCGAGCCGGGGCCGG + Exonic
1160527835 18:79547771-79547793 CCGACGCCTCGGGCTGGGCATGG + Intergenic
1160719213 19:590107-590129 GCAACGCCTCGGCCCGGGGCGGG - Exonic
1160768842 19:821567-821589 CGGGCGCCGCAGGCCGTGGCTGG + Exonic
1160769021 19:822046-822068 CAGACGCCGCAGCCAGGGGCGGG + Intergenic
1160809602 19:1007742-1007764 GCGACGCCGCGGGGCGTGGTGGG - Exonic
1160810683 19:1011709-1011731 CCGCCGGCGCAGGGCGGGGCGGG - Intronic
1160935419 19:1592427-1592449 CCCAGGCCGCGGCCCGGGGCAGG + Intronic
1161063600 19:2227155-2227177 CCTCCGGCGGGGGCCGGGGCGGG - Intronic
1161267124 19:3369555-3369577 CCCACTCGGCGGGCCGGGCCCGG - Intronic
1161664672 19:5568063-5568085 CCGGCCCGGCGGGGCGGGGCGGG + Intergenic
1161724593 19:5921170-5921192 CCGACGGCGGGGGCTGTGGCCGG - Intronic
1162019606 19:7862660-7862682 GCGGGGCCGCGGGCGGGGGCGGG - Intronic
1162113353 19:8413340-8413362 CCGACGGGCCGGGCCGGGCCGGG + Intronic
1162731779 19:12722477-12722499 CCGCCGCTGCTGCCCGGGGCCGG - Intronic
1162752668 19:12838453-12838475 CCGCCGCAGCGGGCAGGGGAGGG - Intronic
1163027045 19:14518478-14518500 CCGGCGCCGCGGGGGCGGGCGGG - Intronic
1163601450 19:18251684-18251706 CCGAGGGCGGGGGCGGGGGCGGG - Intronic
1163700009 19:18782198-18782220 CGGCCGCAGCGGGCGGGGGCAGG + Exonic
1164639164 19:29812100-29812122 CCGCCGCCGCCTGCCGGGACTGG + Exonic
1164855500 19:31517648-31517670 CAGAGGCCGCGGGCTGGGGTGGG + Intergenic
1165204612 19:34172821-34172843 AGGAGGCCGCGGGCCGGAGCGGG - Intronic
1165311263 19:35030612-35030634 CGGACGCCGGGCCCCGGGGCTGG + Intergenic
1165349386 19:35268093-35268115 CCGGCGGCGCGGGCGCGGGCCGG - Intergenic
1165349787 19:35269308-35269330 CCGAGGCCGGGGGCCGGGGGCGG - Intronic
1165775705 19:38403306-38403328 CCGAGGCAGCGGGAGGGGGCGGG - Intronic
1166091632 19:40513042-40513064 CCGGCGCCGCTGGCAGAGGCTGG + Exonic
1166677433 19:44748507-44748529 CAGGCGCCGCGGGCCGGGAGGGG + Intronic
1167040290 19:47019791-47019813 CCAGCGCTGCGGGCGGGGGCGGG - Intergenic
1167503957 19:49861771-49861793 CAGACGCCGCGAGCCGCGCCAGG - Exonic
1167649031 19:50719588-50719610 CCCCCCCCGCGGGCCGGGCCTGG + Intergenic
924987950 2:288316-288338 GCGGCGCCGCGCGCCGGGCCCGG + Intronic
925084486 2:1097245-1097267 CCTGCACCGCTGGCCGGGGCGGG + Intronic
925610355 2:5696706-5696728 CCGGGCCCGCGGGCCGGGGAGGG + Exonic
926095691 2:10079821-10079843 CCGGCGCCCAGGGCTGGGGCGGG + Intronic
926130929 2:10302832-10302854 CCGGAGGCGGGGGCCGGGGCGGG - Intergenic
926155026 2:10448687-10448709 CAGCTGCCGCGGGCCGGGGCCGG - Intergenic
927125997 2:20012716-20012738 TCGAGGCCCCGGGGCGGGGCGGG - Intergenic
928314068 2:30232413-30232435 CCGACGCCCCGCGCCCGGCCCGG - Intronic
928341587 2:30447501-30447523 CCGAGGTCGCGGCCCGGGGAAGG - Intronic
928964955 2:36966758-36966780 CCTACGCGGCGAGCCGGGGCGGG - Intergenic
930177409 2:48314856-48314878 GCTGCGCCGCGGGCTGGGGCGGG - Intronic
930700572 2:54455937-54455959 CCGACCAGGCTGGCCGGGGCGGG - Intergenic
932496857 2:72149762-72149784 CCGACGCTGCGGGCGGTGGAGGG - Intergenic
932605504 2:73163074-73163096 CTGACCCCGTGGGGCGGGGCAGG - Intergenic
934933152 2:98444928-98444950 CGGGCTCCGTGGGCCGGGGCAGG + Exonic
934966877 2:98731172-98731194 CCGGCGGGGCGGGGCGGGGCGGG - Intergenic
935137760 2:100322237-100322259 CTGAGACCGCGGGCGGGGGCGGG + Exonic
935645318 2:105329644-105329666 CCCAGGCCGCGGGGCGGCGCGGG - Exonic
935645334 2:105329677-105329699 CAGGAGCCGCGGGCCGGAGCGGG - Exonic
936938302 2:117859036-117859058 CCGACGCCGCTGGGTGGGGGAGG + Intergenic
937261154 2:120587425-120587447 TCGGGGCCGCGGGCCGGGCCGGG - Intergenic
938368843 2:130756268-130756290 CCGGCGCCGCGCGCCGCGGCCGG - Intronic
938934508 2:136116855-136116877 CAGCCGCGGCGGCCCGGGGCTGG - Intronic
942463907 2:176188761-176188783 CTGAGGGCGCAGGCCGGGGCCGG - Exonic
943185301 2:184598882-184598904 CAGCCGCAGCGCGCCGGGGCCGG - Exonic
943658669 2:190534825-190534847 CCGAGGCCGCGGGCGGAGGCTGG - Intergenic
944703454 2:202265640-202265662 CCGCCACAGCGGGCTGGGGCGGG - Intergenic
945235141 2:207626036-207626058 GCGCCGCCTGGGGCCGGGGCTGG - Intergenic
947723257 2:232381701-232381723 CCGACGCCGCGCACCCGGGGCGG + Exonic
949004413 2:241637195-241637217 GCGAGGACGCGGGCGGGGGCTGG - Exonic
1168830224 20:841601-841623 CAGAGGCCGCGGGGCAGGGCTGG - Intronic
1169065487 20:2692624-2692646 CCGCCGCCGCGGCCCGGGCCCGG + Intergenic
1169143575 20:3238979-3239001 CTGCCTGCGCGGGCCGGGGCCGG - Intronic
1169438074 20:5611032-5611054 GCCACCCCGCGGGGCGGGGCCGG + Intergenic
1171779660 20:29408054-29408076 CCGTCGCCGGGGGCCAGGCCTGG - Intergenic
1171858895 20:30376899-30376921 GCGCCGCCGCAGGCCGGGGAGGG + Intergenic
1172146713 20:32762644-32762666 GCGGAGCCGCGGGTCGGGGCTGG - Exonic
1172482231 20:35277845-35277867 CCGGCGCCGCAGGCTGGGGCTGG + Intergenic
1172775908 20:37406759-37406781 CCAACCCCGCGCGCCGGGACAGG + Intergenic
1173589118 20:44210560-44210582 CCGACGCCTCCTGCCTGGGCCGG - Intronic
1174407741 20:50313013-50313035 CCCAGGCCGGGGGCCGGGGAGGG + Intergenic
1174874024 20:54208324-54208346 CCGAGGCGGGGCGCCGGGGCTGG + Intronic
1175248896 20:57597209-57597231 CGGAGGGCGCGGGCGGGGGCTGG + Intergenic
1175279093 20:57790883-57790905 CTGACGCCGCAGACCTGGGCTGG - Intergenic
1175428888 20:58889282-58889304 CCGCCGCCCCGCGCCGGGACAGG - Intronic
1175877799 20:62238654-62238676 CCTGGGCCGCGGGCTGGGGCTGG + Intronic
1175927117 20:62476307-62476329 CCTTCGGCGGGGGCCGGGGCAGG - Intergenic
1176005872 20:62861940-62861962 CCGCCGACGTGGGGCGGGGCCGG - Intergenic
1176131812 20:63499461-63499483 CAGACGCCGAGGACCGGAGCCGG + Intergenic
1176201544 20:63863038-63863060 GCGCCGACGCGGGGCGGGGCGGG + Exonic
1176207208 20:63895481-63895503 GCGACGCCGCGGCCTGGGCCGGG + Intronic
1176380513 21:6110399-6110421 GCGCCGCTGAGGGCCGGGGCCGG + Intergenic
1177187961 21:17819098-17819120 CCAACGCCGAAGGCCGGGCCAGG - Intronic
1178334417 21:31731431-31731453 CCGAGGTCGCGGTCCGGGGGTGG + Intronic
1179742959 21:43427841-43427863 GCGCCGCTGAGGGCCGGGGCCGG - Intergenic
1181017676 22:20080477-20080499 CCGAGGCCGCGGGCGGGGCGGGG + Intronic
1181631893 22:24155974-24155996 CGCTCGCGGCGGGCCGGGGCGGG - Intronic
1182903983 22:33920841-33920863 CGGGCGCCGCTGGCCGGAGCCGG + Intronic
1183149829 22:36028709-36028731 GCGGCGCGGCGGGCCGGGCCGGG - Intergenic
1183720136 22:39557779-39557801 GCGGCGCTCCGGGCCGGGGCGGG - Intergenic
1183751179 22:39721595-39721617 CCGCCCCCGGGGTCCGGGGCTGG - Intergenic
1184260105 22:43310115-43310137 GCAACGAGGCGGGCCGGGGCTGG - Intronic
1184508129 22:44916574-44916596 CCGTTGCCCCGGGCCGGGACCGG - Exonic
1184731822 22:46374888-46374910 CCGAGGCCGAGGCCCCGGGCTGG - Intronic
1185317635 22:50185887-50185909 CTGGGGCCGCGGGGCGGGGCGGG - Intergenic
1185420355 22:50731366-50731388 CCGAGCCCGCGGCCCGGGGTGGG - Intergenic
950193404 3:10993007-10993029 CCGCTGCCGCGAGCCGGGCCGGG + Intronic
950548985 3:13655202-13655224 CCGCAGCCCCTGGCCGGGGCTGG + Intergenic
951962968 3:28349142-28349164 CCTCCGCGGCGGGACGGGGCGGG + Exonic
952706194 3:36380407-36380429 CGGGCGCGGCGGGGCGGGGCAGG + Exonic
954305698 3:49724206-49724228 CCGGGGCCGTGGGGCGGGGCCGG - Intergenic
954677716 3:52324938-52324960 CTGCGTCCGCGGGCCGGGGCAGG - Intronic
954717536 3:52533923-52533945 CGGACCCGGCGGGGCGGGGCGGG + Intronic
954717541 3:52533928-52533950 CCGGCGGGGCGGGGCGGGGCGGG + Intronic
956414783 3:69013963-69013985 CCGACGGCACGTGCCGGCGCCGG + Intergenic
956798803 3:72738893-72738915 CGGGCGTCGCGGGGCGGGGCGGG - Intergenic
958732321 3:97972479-97972501 CCGGCGTGGCGGGGCGGGGCGGG - Intergenic
959078933 3:101779606-101779628 CCGGCGGGGCGGGGCGGGGCGGG + Intronic
963107667 3:141660408-141660430 CCGGCGGGGCGGGCAGGGGCCGG + Intergenic
963870316 3:150408759-150408781 CGGGAGCCGCGGGCCGGAGCTGG - Exonic
966372134 3:179261331-179261353 CCCCCCCCGCGGGCCGGGCCAGG + Intronic
966390832 3:179451212-179451234 GTGACGGCGCGGGGCGGGGCGGG - Intronic
968428088 4:536150-536172 CAGACTCGGCGGGCCCGGGCTGG + Intronic
968514842 4:1011703-1011725 GCGGGGCCGGGGGCCGGGGCCGG - Intronic
968550091 4:1217624-1217646 CTAAAGCCGCGGGCCGGCGCCGG + Intronic
968660025 4:1795002-1795024 CGGGCGCGGCGGGCCGGGGAGGG + Intronic
968966597 4:3772087-3772109 CCGACTCCGGGGGTGGGGGCTGG + Intergenic
970202876 4:13627484-13627506 CCGCCGCCGGGCCCCGGGGCTGG - Exonic
976398527 4:84582966-84582988 CCGGCTCCGGGGGGCGGGGCGGG + Exonic
977536653 4:98261727-98261749 CGCACGCCGGGTGCCGGGGCTGG + Intronic
977957965 4:103052346-103052368 CCCAAGCCCCGGGCCGTGGCAGG - Intronic
980969986 4:139558592-139558614 CCGACGGCGGGGGCCGGGGTTGG - Intronic
981475082 4:145180040-145180062 TCGACGCCCCGGCCTGGGGCAGG + Intronic
984462990 4:180059156-180059178 CCGCCGCCGCGGCCGGGCGCAGG - Intergenic
984760210 4:183357032-183357054 CCGGCGGGGCAGGCCGGGGCGGG - Intergenic
984992718 4:185396652-185396674 CCGGCGCCGGGGGCAGGGGGAGG - Exonic
985129098 4:186723882-186723904 CCGGCGCCGGCGGGCGGGGCCGG - Intronic
985580544 5:693421-693443 CGGACGCTGGGGGCCGGGGGCGG - Intergenic
988577764 5:32444027-32444049 TCCCCGCCGCGGGCCGGGCCGGG + Intronic
989178879 5:38556715-38556737 CCGGGGCCGGGGGCAGGGGCGGG - Intronic
992124359 5:73626013-73626035 CGGCCGCCGCGAGCCGGGCCGGG + Intergenic
997297536 5:132777308-132777330 CCGGTCCCGCGGGCGGGGGCAGG - Exonic
998583827 5:143405092-143405114 CCGACGCGGCGAGCTGGGGAAGG - Intronic
999715773 5:154358761-154358783 ACGACGCTGAGGGCCAGGGCAGG + Intronic
1001401974 5:171451216-171451238 GAGGCGCCGGGGGCCGGGGCCGG - Intronic
1001628177 5:173154424-173154446 CAGAAGCCGCTGGCGGGGGCAGG - Intronic
1002082250 5:176744024-176744046 CCGTCCCGGGGGGCCGGGGCAGG + Intergenic
1002610135 5:180412228-180412250 CCGGCGGGGCGGGGCGGGGCGGG + Intergenic
1002622099 5:180494939-180494961 CCGGGGGCGCGGCCCGGGGCGGG - Intronic
1002927102 6:1611042-1611064 CCGGCGGCGCGGGCGGGGGCTGG - Exonic
1003098013 6:3157348-3157370 CCGAGGGTGCGGGCTGGGGCCGG - Intronic
1003427354 6:6006627-6006649 TCCGCGCCTCGGGCCGGGGCAGG + Intronic
1003645415 6:7910249-7910271 CGGGCGCCGCGGCTCGGGGCCGG - Intronic
1003868500 6:10383679-10383701 ACGCCGCCCCGGGCCGGGACGGG + Intergenic
1003871176 6:10404464-10404486 CCCCGGCCGCGGGGCGGGGCGGG + Intronic
1004140530 6:13013747-13013769 CCGCCGCGGCGGGGCGGGTCGGG - Intronic
1004262065 6:14117536-14117558 CCGCCCCCGCGCGCCCGGGCCGG - Intronic
1006177508 6:32131302-32131324 CCGAGGCGGCGGGGGGGGGCGGG + Intergenic
1006303886 6:33207834-33207856 CAGGAGCCGCGGCCCGGGGCGGG - Intergenic
1006599105 6:35214113-35214135 CCGCCGCCGCTGGCAGAGGCCGG + Intergenic
1007431513 6:41779903-41779925 CCGCGGCCGCGGGGCGGGGCGGG - Intronic
1010083106 6:71886727-71886749 CCGCCCCCGCCGGCCGAGGCTGG + Intronic
1012245777 6:96924461-96924483 CCGACGGCGGGGGCGGGGGCGGG + Intergenic
1013207417 6:107957787-107957809 CGGACGCCGCGGGCTGGGGCCGG + Intronic
1018330989 6:162727513-162727535 CCGGCGGCGCGGGCCGGGGACGG + Intronic
1019112116 6:169724554-169724576 GCGACGTGCCGGGCCGGGGCGGG - Intronic
1019263848 7:101222-101244 CCATCTCCGCGGGCCTGGGCAGG + Intergenic
1019437149 7:1028173-1028195 CTGTCGCCGCGGGGCGGGGCTGG + Intronic
1019473394 7:1232960-1232982 GCGGGGGCGCGGGCCGGGGCCGG - Exonic
1020130499 7:5556335-5556357 CAGGGGCCGCGGGCCGGGGGCGG - Intronic
1020204704 7:6105355-6105377 CCGAAGGGGCGGGCTGGGGCCGG - Intronic
1021451135 7:20784855-20784877 CCGTCGCCGCTGGCCGGCGCGGG - Exonic
1022106384 7:27200298-27200320 GGGACGGCGCGGGCCGCGGCGGG - Intergenic
1022207605 7:28179779-28179801 CGGCGGCCGCGGGCGGGGGCCGG - Intronic
1024043836 7:45574485-45574507 CCGGCGCCCCGGGCCGGCGAGGG + Intronic
1024639395 7:51316962-51316984 CGCTCGCCGCGGGCCGGGTCGGG - Intergenic
1025032894 7:55572064-55572086 CGGAAGGCGCGGACCGGGGCGGG + Intronic
1025992509 7:66506340-66506362 CCGCCGAGGCGGGGCGGGGCGGG - Intergenic
1026909455 7:74083875-74083897 CGGAGGGCGCGGGCCGGGCCGGG - Intronic
1026968368 7:74454118-74454140 TCCTGGCCGCGGGCCGGGGCCGG + Exonic
1026994500 7:74606658-74606680 CCGCCGCTCCCGGCCGGGGCAGG - Intergenic
1027592540 7:80134705-80134727 GCGGCGCCGGGGTCCGGGGCCGG + Intronic
1028830779 7:95324580-95324602 CCGACCCGGCGGGGAGGGGCGGG - Exonic
1029363239 7:100101651-100101673 CCGGGGCCGCAGGGCGGGGCAGG + Exonic
1029699027 7:102234255-102234277 CGGACGCAGCCGGCCCGGGCGGG - Intronic
1031043520 7:116862820-116862842 CCGAGGCCCCGCGCGGGGGCAGG + Intronic
1031986713 7:128168261-128168283 CAGAGGACGCGGGCTGGGGCGGG + Intergenic
1033165578 7:139036043-139036065 GCGGCGCAGCGAGCCGGGGCGGG + Intergenic
1033253181 7:139777780-139777802 CCGGCGCCGGGGGAGGGGGCCGG + Intronic
1033299820 7:140176344-140176366 CGGGCGCGGCGGGGCGGGGCGGG + Intronic
1033477202 7:141702234-141702256 CCGCCGCCGCCCGCCGGGTCTGG + Intergenic
1034129077 7:148699089-148699111 GCGACACCGCGGCTCGGGGCCGG - Intronic
1034222993 7:149460160-149460182 GCGACTCCGGGGGCCCGGGCCGG - Intronic
1034227921 7:149497438-149497460 GCGGCGCCGTGTGCCGGGGCCGG + Intronic
1034433278 7:151051363-151051385 CCGACGGGGCGGAACGGGGCAGG + Intronic
1035153207 7:156892622-156892644 CCGAGGCCGCGGGGCGGGGGCGG + Intronic
1036723718 8:11201029-11201051 CCGGCGCCGGGGGCCGCGGGAGG + Exonic
1039454221 8:37697037-37697059 GCGGCGCCACGGGGCGGGGCGGG - Intronic
1039484404 8:37899622-37899644 CCGGCGGGGCGGGGCGGGGCGGG - Intergenic
1039996883 8:42541758-42541780 CGGGCGGCGCGGGGCGGGGCCGG - Intronic
1042235868 8:66613027-66613049 GCGGCGCTGCGGGCCGGGGTCGG - Exonic
1042695094 8:71547411-71547433 CCGACGCCACGGGCCTTGGGCGG + Intronic
1043053361 8:75407978-75408000 CCGCCGCCCGGGGCCCGGGCTGG + Intronic
1044832256 8:96261847-96261869 CCGCCACCGCGGCCTGGGGCAGG - Exonic
1045432061 8:102123824-102123846 CCCGCCCCGGGGGCCGGGGCCGG - Intronic
1045443615 8:102239003-102239025 CCGGCGCGGCGGGGCGGGGCCGG - Exonic
1045489097 8:102655758-102655780 CCCGCGCCGCGGGCGGGGGTGGG + Exonic
1046547435 8:115669114-115669136 CCGCCGCCGCCCGCCGGGACCGG + Intronic
1046770429 8:118111968-118111990 CCGGCGCCTCGGCCCGCGGCCGG - Intergenic
1047393722 8:124475032-124475054 CCGGGGCCGCGGCCGGGGGCGGG - Exonic
1048072873 8:131040254-131040276 CCGACGCCCCCGGCCGGCGACGG - Exonic
1049409123 8:142464666-142464688 CCGGCGGCCCGGCCCGGGGCCGG - Exonic
1049419565 8:142510810-142510832 GCGGGGCGGCGGGCCGGGGCCGG + Intronic
1049645480 8:143733923-143733945 CCGGGGGCGCGGGCTGGGGCTGG - Intergenic
1049657398 8:143804872-143804894 CAGAGGGCGCGGGGCGGGGCAGG + Intronic
1049761470 8:144333770-144333792 GCGACGCCGGAGGCGGGGGCGGG - Exonic
1049844491 8:144793269-144793291 CCGAGGCCGCGGGTGGGGGATGG + Intergenic
1049850335 8:144827217-144827239 CTGGGGACGCGGGCCGGGGCCGG - Intergenic
1049896128 9:113513-113535 CCGGCTCCGCGGGGCGGCGCGGG + Intergenic
1053435016 9:38068738-38068760 CGGACGCCCCCCGCCGGGGCCGG - Exonic
1054175050 9:61869176-61869198 CCGGGGCCGGGGGCCGGGGCCGG + Intergenic
1054662487 9:67711617-67711639 CCGGGGCCGGGGGCCGGGGCCGG - Intergenic
1055090986 9:72364795-72364817 CCGCCGCCGCGGGCCGGGAGCGG + Intronic
1057245520 9:93451655-93451677 CCGAGGCTGAGGGCCGGGGCGGG - Intronic
1057313508 9:93955413-93955435 GCGGCGGCGCGGGGCGGGGCGGG - Intergenic
1057773352 9:97985072-97985094 CCCCCGCCGCGGACCGGCGCGGG + Intronic
1058851155 9:109013244-109013266 CCGCCATCGCGGGCCGCGGCGGG + Intronic
1059405829 9:114098075-114098097 GCGCCCCCGCGGGGCGGGGCTGG - Intronic
1059769856 9:117414888-117414910 CCGGAGCCCCGAGCCGGGGCCGG + Exonic
1060596821 9:124853503-124853525 CCGCCGGGGCGGGGCGGGGCCGG + Exonic
1060770156 9:126326743-126326765 CCGCCGCCGCGGCCCGCGGAGGG + Intergenic
1060814359 9:126626918-126626940 CGGACGCTGCGGGCCCGGCCGGG - Intronic
1060855929 9:126915026-126915048 CCGACGGGGCGGGGCGGGGCGGG + Intronic
1060952322 9:127612201-127612223 CCGCCGGCGCGCGCGGGGGCGGG - Intergenic
1061065631 9:128275934-128275956 CCGACATCGCGGGGCGGGGAGGG + Exonic
1061666145 9:132161988-132162010 CCGGAGACGCGGGCCGGGGGAGG - Exonic
1061818323 9:133208934-133208956 CCGAGGCCCAGGGCCGGAGCAGG - Intronic
1061859363 9:133460246-133460268 CCGCCGGGGCGGGGCGGGGCAGG - Intronic
1061975716 9:134067361-134067383 CCGTCGCCGCGCGCCGCGGCCGG - Intronic
1062004661 9:134233192-134233214 CCGTGGCCGTGGGCAGGGGCAGG - Intergenic
1062242128 9:135546424-135546446 CCGAGGCCCAGGGCCGGAGCAGG + Intronic
1062305845 9:135906947-135906969 CCAGGGGCGCGGGCCGGGGCCGG - Intronic
1062341529 9:136095653-136095675 CCGAGGCCGGGGCCCGGGGAGGG - Intergenic
1062364730 9:136203219-136203241 GCGGGGCCGCGGGGCGGGGCGGG + Intronic
1062472491 9:136712587-136712609 CGGCCGCTGCGGGCCGGGCCGGG + Exonic
1062659141 9:137619195-137619217 CCGCCGCCTCAGGCCGAGGCCGG + Intronic
1185761321 X:2691461-2691483 CGGAGGGCGCGGGCCGGGACTGG + Intronic
1187419536 X:19122517-19122539 CCGAGGCCGCGGGCGGGGGGAGG - Exonic
1188451199 X:30309356-30309378 CGGGCGCCGCGGGCCATGGCGGG - Exonic
1189054672 X:37686227-37686249 CCGAGGCTGCGGCCTGGGGCTGG - Intronic
1189320296 X:40083503-40083525 CCGACGCCCCGGGAGGAGGCCGG - Intronic
1191085536 X:56563768-56563790 CCGCCGCAGCGGGCTGGGCCGGG - Exonic
1196443297 X:115732815-115732837 CCGCCGCTGCTGGCCGGCGCCGG + Intergenic
1196444225 X:115737122-115737144 CCGCCGCTGCTGGCCGGCGCCGG - Intergenic
1196445618 X:115844730-115844752 CCGCCGCTGCTGGCCGGCGCCGG + Intergenic
1196446289 X:115847711-115847733 CCGCCGCTGCTGGCCGGCGCCGG + Intergenic
1196446960 X:115850692-115850714 CCGCCGCTGCTGGCCGGCGCCGG + Intergenic
1196447629 X:115853675-115853697 CCGCCGCTGCTGGCCGGCGCCGG + Intergenic
1196448299 X:115856654-115856676 CCGCCGCTGCTGGCCGGCGCCGG + Intergenic
1196448968 X:115859645-115859667 CCGCCGCTGCTGGCCGGCGCCGG + Intergenic
1196449639 X:115862636-115862658 CCGCCGCTGCTGGCCGGCGCCGG + Intergenic
1196450308 X:115865619-115865641 CCGCCGCTGCTGGCCGGCGCCGG + Intergenic
1196450978 X:115868604-115868626 CCGCCGCTGCTGGCCGGCGCCGG + Intergenic
1196451649 X:115871583-115871605 CCGCCGCTGCTGGCCGGCGCCGG + Intergenic
1196452320 X:115874570-115874592 CCGCCGCTGCTGGCCGGCGCCGG + Intergenic
1196452990 X:115877539-115877561 CCGCCGCTGCTGGCCGGCGCCGG + Intergenic
1196453660 X:115880532-115880554 CCGCCGCTGCTGGCCGGCGCCGG + Intergenic
1196454329 X:115883541-115883563 CCGCCGCTGCTGGCCGGCGCCGG + Intergenic
1196455409 X:115888613-115888635 CCGCCGCTGCTGGCCGGCGCCGG + Intergenic
1196707343 X:118727688-118727710 CCGGCGGCGGGGGCGGGGGCGGG + Exonic
1198388143 X:136147721-136147743 CCGCCGCCGCCGCTCGGGGCTGG + Intronic
1199846289 X:151694938-151694960 CCGGCGGCACGGGCGGGGGCAGG + Intergenic
1200086889 X:153611421-153611443 CCACCCCCCCGGGCCGGGGCAGG + Intergenic
1200231029 X:154443988-154444010 CCGGCGGCGGGGGCTGGGGCGGG + Intergenic
1200292677 X:154887064-154887086 GCGTCGCCCCGGGCCCGGGCTGG - Exonic
1200339521 X:155382804-155382826 GCGTCGCCCCGGGCCCGGGCTGG - Exonic
1200346949 X:155457889-155457911 GCGTCGCCCCGGGCCCGGGCTGG + Exonic