ID: 1072640996

View in Genome Browser
Species Human (GRCh38)
Location 10:97211308-97211330
Sequence GGAGCTGGTCCTCCACAATT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 109
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 96}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1072640996_1072640999 -5 Left 1072640996 10:97211308-97211330 CCTAATTGTGGAGGACCAGCTCC 0: 1
1: 0
2: 1
3: 11
4: 96
Right 1072640999 10:97211326-97211348 GCTCCAGCTGCCGCCCTCCTGGG No data
1072640996_1072640998 -6 Left 1072640996 10:97211308-97211330 CCTAATTGTGGAGGACCAGCTCC 0: 1
1: 0
2: 1
3: 11
4: 96
Right 1072640998 10:97211325-97211347 AGCTCCAGCTGCCGCCCTCCTGG No data
1072640996_1072641004 11 Left 1072640996 10:97211308-97211330 CCTAATTGTGGAGGACCAGCTCC 0: 1
1: 0
2: 1
3: 11
4: 96
Right 1072641004 10:97211342-97211364 TCCTGGGCCCCTGCCCGCCTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1072640996 Original CRISPR GGAGCTGGTCCTCCACAATT AGG (reversed) Intronic
900893158 1:5464261-5464283 TGAGCTGGGCCTCCCCTATTAGG - Intergenic
900954056 1:5875997-5876019 GGAGCTGGCCTTTCACACTTGGG + Intronic
901404946 1:9039436-9039458 GCGGCTGGTCCTCCACGTTTTGG + Intronic
904346078 1:29870842-29870864 GGAGCTGGACCTCCACACACTGG + Intergenic
905233420 1:36529664-36529686 GTAGCTTCTCCTCCACAATCTGG + Intergenic
913205046 1:116530864-116530886 GGAGAAGGTCCTCCAATATTTGG + Intronic
921194059 1:212735796-212735818 GGAGGTGGTCATCTACAAGTCGG + Intronic
923374088 1:233342697-233342719 GAAGCTGGTCCTTGAAAATTGGG + Intronic
923473136 1:234309850-234309872 GAAGCTGGCCCTTCACAGTTGGG - Intronic
1066191749 10:33062271-33062293 GGGGCTGGTCTTCCAAAATCAGG - Intergenic
1071360890 10:84845001-84845023 GTAACTGGTCCTCCAAAATGAGG - Intergenic
1072640996 10:97211308-97211330 GGAGCTGGTCCTCCACAATTAGG - Intronic
1074913225 10:117931189-117931211 GCAGATGGTCCTCCTCAATTTGG - Intergenic
1076290950 10:129344820-129344842 GTAGCTGGTCCCCCAAAATGTGG - Intergenic
1077431126 11:2516511-2516533 GGAGCTGGACCTTCCCAATTCGG + Intronic
1077726248 11:4677654-4677676 GGAGATTGTCCTCCATAATGGGG - Intergenic
1079402799 11:20119367-20119389 GGACCTGGTCCTCGACATGTGGG + Intronic
1084690317 11:70721437-70721459 GGAGCTGGTGCTCCACCACAGGG + Intronic
1085046950 11:73359257-73359279 GGAGCTGTCCCTCCACCCTTGGG - Intronic
1086677749 11:89630222-89630244 GGAGCAGGTCCCCCAAAATCTGG + Intergenic
1088791882 11:113233413-113233435 GGAACTGCACCTCCAGAATTAGG + Intronic
1090214274 11:124947129-124947151 GGAGCAGGGCCTCAACACTTTGG + Intergenic
1092150047 12:6241712-6241734 GGAGCTGGCTGTCCACAATCAGG + Intergenic
1095647852 12:44570279-44570301 GATGCTGGTGCTCCACAATTAGG + Intronic
1096608931 12:52788449-52788471 GGAGCTGTTGCTTCACATTTGGG - Intergenic
1099116097 12:78626271-78626293 GCAGATTGTCCTCCACAATACGG - Intergenic
1101196963 12:102393605-102393627 GGTGCTGGTCCTAGATAATTTGG - Intergenic
1102407830 12:112689369-112689391 GGAGATTTTACTCCACAATTTGG - Intronic
1102742378 12:115219416-115219438 GGAGCTGTTCCTCCCCTAGTAGG + Intergenic
1105458836 13:20565759-20565781 GCAGTTGGTCCTCCACAAGGTGG - Intergenic
1106296805 13:28421510-28421532 GCAGCAGCTCCTCCACCATTGGG - Intronic
1115099900 14:29686213-29686235 GGAGAGAGTGCTCCACAATTTGG + Intronic
1115378004 14:32699989-32700011 GGAGCTTTTCCTTCACAAGTGGG - Intronic
1115479963 14:33851081-33851103 GGAGCTGGGACTCCACACTGAGG + Intergenic
1115973657 14:38973566-38973588 GGAGCTGGTCCTCCACACAGAGG + Intergenic
1123144248 14:106112597-106112619 GGAGCTGCTTCTCCACACCTTGG - Intergenic
1123192231 14:106582478-106582500 GGAGCTGCTTCTCCACACCTTGG - Intergenic
1126145367 15:45468631-45468653 GGAGCTGCTTCTGCAGAATTAGG - Intergenic
1128842091 15:70858774-70858796 GCAGCTGCTCCTACACAAGTGGG + Intronic
1129109189 15:73327878-73327900 GGACCTGGACCTCCACACCTGGG + Intronic
1129311556 15:74715351-74715373 GGAGGTGGCCCTCCCCAATGTGG + Intergenic
1131050045 15:89341738-89341760 GGAGCTGGTGCTGCACCATGTGG + Intergenic
1135302191 16:21340146-21340168 GCAGATGGTCCTCCCCAATGTGG - Intergenic
1141703859 16:85654316-85654338 GGAGCGGGGGCTCCACAATGAGG - Exonic
1144044798 17:11445775-11445797 GGAGCAAGGCCTCCACAAGTGGG + Intronic
1145734527 17:27218092-27218114 GGAGATGGTTCTCCCCAACTGGG - Intergenic
1146225441 17:31062176-31062198 GGAGATGGTTCTCCCCAACTGGG + Intergenic
1150348093 17:64420229-64420251 GGTGCTGATGCCCCACAATTGGG + Intergenic
1154105929 18:11523035-11523057 GGAACTGGAGCTCCACACTTAGG - Intergenic
1157843878 18:50984274-50984296 GGAGCTGGTCTTCCATTATGTGG + Exonic
1160976817 19:1796822-1796844 GAAGCTGCTCTTCCACAATGCGG - Exonic
1162498157 19:11034970-11034992 GGAGCTCGTCCTCCTCCATGAGG - Exonic
1162931517 19:13960046-13960068 GGAGCTGGCCCTCCTCAGTGGGG - Exonic
1165459663 19:35936900-35936922 GGAGCCGGAACCCCACAATTTGG + Exonic
1167693519 19:51001381-51001403 GGAGCTGGGACTCCTAAATTAGG + Intronic
925424241 2:3735513-3735535 GGAGGAGGTCATCCACAAGTTGG + Intronic
925998398 2:9310633-9310655 GGGGCTGCACCTCCACACTTTGG + Intronic
930851336 2:55964278-55964300 TGAGCTTGTCGTCCAGAATTAGG - Intergenic
933093316 2:78146864-78146886 GCAGCTGGTCCTCCAGTAGTTGG - Intergenic
937088256 2:119186345-119186367 GAAGCTGCTCCTCCACTCTTAGG - Intergenic
937894999 2:126971719-126971741 GGGGCTGGTCCTCCACAGGCTGG - Intergenic
937895010 2:126971751-126971773 GGGGCTGGTCCTCCACAGGCTGG - Intergenic
940587293 2:155669640-155669662 TGAGGTGGACCTCCAAAATTTGG - Intergenic
942044354 2:172090746-172090768 GGAGCTGGCCCTCCACCTTTGGG + Intergenic
942791723 2:179768617-179768639 GGAGCTCTTCCCCCACATTTGGG + Intronic
1168911165 20:1448269-1448291 GGAGCTGAGCCACCACCATTTGG + Intronic
1175978079 20:62723584-62723606 GGATCTGGTCCTCCACCATGGGG - Intronic
1177683869 21:24411059-24411081 GGAGCAAGTCCCCCAAAATTTGG - Intergenic
1179262024 21:39765752-39765774 GGAGATGATCATCCACAATGTGG + Exonic
1180102774 21:45597290-45597312 GGTGGTGGTCCTTCACAAGTGGG - Intergenic
1183028449 22:35084137-35084159 GCAGCTGGTGCTGCCCAATTGGG - Intronic
1183186331 22:36293564-36293586 GGAGCTGGTCCTGCTGATTTAGG + Intronic
1184279672 22:43429827-43429849 GCAGCTGGTCCTCCACACCCAGG - Intronic
1184648946 22:45910880-45910902 GCAGCTGGGCATCCAGAATTGGG - Intergenic
949112528 3:279514-279536 GGTGCTGTTCTTCCACAATCTGG + Intronic
950707925 3:14794432-14794454 GGAGTTGGCCCTGCTCAATTTGG - Intergenic
954114366 3:48457293-48457315 GAAGCATGTTCTCCACAATTTGG + Exonic
955860663 3:63326277-63326299 AGAGCTCATCCTCCACAATCAGG - Intronic
956710000 3:72030646-72030668 GGAACTGGCCCTCCAAAATCTGG - Intergenic
958818159 3:98941162-98941184 GGAGATGGTCCTCCCCAATGTGG + Intergenic
961366018 3:126399912-126399934 GGATCTTGTCCTCCAAAAATTGG + Intronic
966462981 3:180198196-180198218 GCAGGTGGCCCTCCTCAATTTGG + Intergenic
968977118 4:3827809-3827831 GAGGCTGGTCCTCCACCATCGGG - Intergenic
969069396 4:4522581-4522603 TGAGTTGCTCCTCCACATTTCGG - Intronic
969156533 4:5215872-5215894 GAAGATGGACCTCCACAATTAGG + Intronic
970683117 4:18534459-18534481 TAAGCTGGTCCTCAACAAATTGG - Intergenic
971813895 4:31462705-31462727 GGAGCAGGTCCCCCAAAATCTGG + Intergenic
988871231 5:35392316-35392338 GCAGATGGCCCTCCCCAATTTGG + Intergenic
989225107 5:39018235-39018257 GGACCAGGGCCCCCACAATTTGG + Intronic
990568309 5:57052318-57052340 GGAGCTGGTCCCCCACCATGAGG - Intergenic
990601923 5:57367579-57367601 CCAGCTGGTCCACCACAGTTTGG - Intergenic
994320947 5:98393446-98393468 GCAGCTGTTCCTACACAAGTGGG - Intergenic
999069054 5:148724166-148724188 GGAGTTGGTCCCCCAGAATTGGG + Intergenic
1011882094 6:92041491-92041513 GCAGATTGTCCTCCACAATGTGG - Intergenic
1015880771 6:137867944-137867966 CGGGCTGGTCCTGCACAATTTGG - Intronic
1018766663 6:166938890-166938912 GGAGCTGGACCTCAACAGGTGGG - Exonic
1023022373 7:36021802-36021824 GGAGCTGGACCTACACAGGTTGG + Intergenic
1024566507 7:50685859-50685881 GGAGCTGGTTTTCCAGAATGTGG + Intronic
1034874133 7:154710143-154710165 GGAGCAGGACATCCACAAGTGGG + Intronic
1035980005 8:4359999-4360021 AGAGCTGGAACTCCACAACTGGG - Intronic
1037390581 8:18387530-18387552 GGGGCTGGTCGTCCACAAGGTGG - Intergenic
1038259945 8:25984168-25984190 GGAGCTGGGTCTCCCAAATTTGG + Intronic
1040609370 8:48967497-48967519 GGAGCAGGTCCCCCAAAATCTGG + Intergenic
1042363289 8:67907167-67907189 TGAGCTGGACCTACACATTTGGG + Intergenic
1045953974 8:107885386-107885408 GTAGATGGTCATCCACAATCAGG - Intergenic
1056196351 9:84232559-84232581 GGAGCTGCTCCTCCACAAGTGGG + Intergenic
1188550557 X:31359976-31359998 GAAACTGGGCCTTCACAATTGGG + Intronic
1197405701 X:126046263-126046285 AGAGTTGGTCCCCCTCAATTAGG - Intergenic
1200465379 Y:3509492-3509514 GGACCTGGGGCTCTACAATTAGG - Intergenic