ID: 1072641859

View in Genome Browser
Species Human (GRCh38)
Location 10:97217036-97217058
Sequence ACTTCTGAACATGAGTGCTG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1072641855_1072641859 -8 Left 1072641855 10:97217021-97217043 CCATCAGCGATCCCCACTTCTGA 0: 1
1: 0
2: 1
3: 14
4: 135
Right 1072641859 10:97217036-97217058 ACTTCTGAACATGAGTGCTGAGG No data
1072641854_1072641859 -7 Left 1072641854 10:97217020-97217042 CCCATCAGCGATCCCCACTTCTG 0: 1
1: 0
2: 2
3: 42
4: 271
Right 1072641859 10:97217036-97217058 ACTTCTGAACATGAGTGCTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1072641859 Original CRISPR ACTTCTGAACATGAGTGCTG AGG Intronic
No off target data available for this crispr