ID: 1072654612

View in Genome Browser
Species Human (GRCh38)
Location 10:97321077-97321099
Sequence CCTGGGCACGCACTGGGTTG CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 181
Summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 161}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1072654601_1072654612 12 Left 1072654601 10:97321042-97321064 CCGGCCCGCCTCTCCTCGGTTCA 0: 1
1: 0
2: 0
3: 7
4: 146
Right 1072654612 10:97321077-97321099 CCTGGGCACGCACTGGGTTGCGG 0: 1
1: 0
2: 1
3: 18
4: 161
1072654605_1072654612 4 Left 1072654605 10:97321050-97321072 CCTCTCCTCGGTTCAAGGTCACT 0: 1
1: 0
2: 0
3: 3
4: 123
Right 1072654612 10:97321077-97321099 CCTGGGCACGCACTGGGTTGCGG 0: 1
1: 0
2: 1
3: 18
4: 161
1072654603_1072654612 8 Left 1072654603 10:97321046-97321068 CCCGCCTCTCCTCGGTTCAAGGT 0: 1
1: 0
2: 2
3: 19
4: 517
Right 1072654612 10:97321077-97321099 CCTGGGCACGCACTGGGTTGCGG 0: 1
1: 0
2: 1
3: 18
4: 161
1072654606_1072654612 -1 Left 1072654606 10:97321055-97321077 CCTCGGTTCAAGGTCACTGTTTC 0: 1
1: 0
2: 0
3: 3
4: 118
Right 1072654612 10:97321077-97321099 CCTGGGCACGCACTGGGTTGCGG 0: 1
1: 0
2: 1
3: 18
4: 161
1072654604_1072654612 7 Left 1072654604 10:97321047-97321069 CCGCCTCTCCTCGGTTCAAGGTC 0: 1
1: 0
2: 0
3: 10
4: 137
Right 1072654612 10:97321077-97321099 CCTGGGCACGCACTGGGTTGCGG 0: 1
1: 0
2: 1
3: 18
4: 161

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1072654612 Original CRISPR CCTGGGCACGCACTGGGTTG CGG Exonic
900525958 1:3128817-3128839 GCAGGGCACTCACTGGGCTGTGG - Intronic
900537336 1:3185422-3185444 CCTGGACATGCACTGGGGTAGGG - Intronic
900896018 1:5483464-5483486 CCTGGGACTTCACTGGGTTGGGG + Intergenic
901318660 1:8325501-8325523 TCTGGGCCCGCACTGGTGTGAGG + Intronic
902301544 1:15505946-15505968 CCTGGGCAGGCATTGGGTACTGG - Intronic
903031511 1:20467240-20467262 CCTGGGCACCTGCTGGGTAGCGG - Intergenic
904035426 1:27556234-27556256 CCTGGGGAGGCAGTGGGTGGGGG - Intronic
905137274 1:35808771-35808793 CCTCCGCGCGCACTGGGTAGCGG - Intronic
905264288 1:36740326-36740348 CCAGGGCACCCAATGTGTTGAGG + Intergenic
905395842 1:37665839-37665861 GCTGGGCATTCACTGGGTTCTGG + Intergenic
905922395 1:41728332-41728354 GCTGGGCACTCCCTGGGCTGGGG - Intronic
907384495 1:54117290-54117312 CCTGGGCATGCTCAGGTTTGAGG + Intergenic
909561587 1:77014463-77014485 CCTGGGCAGGGCCTGGGTGGGGG - Intronic
910700974 1:90073664-90073686 CCTGGGCTTTCACTGGCTTGAGG + Intergenic
913505531 1:119513236-119513258 ACTGAGCAAGCAGTGGGTTGTGG - Intronic
920577500 1:207072326-207072348 CCTGGGCACGGAGAGGGCTGAGG - Exonic
921694528 1:218192334-218192356 CCTGGGCACACATTGGGATCAGG - Intergenic
922619835 1:226982798-226982820 CCTCGGCCCCCACTGGGTGGAGG + Intronic
1062839766 10:661329-661351 CCTGGAGACGCTCTGGGTTGAGG + Intronic
1070150309 10:73801129-73801151 CCGGGGCACGCAGGTGGTTGTGG - Exonic
1070697173 10:78572014-78572036 CCTGGGCAGGGAGTGGGTGGTGG + Intergenic
1070733300 10:78846510-78846532 GCTGGGCTCACACTGGATTGTGG + Intergenic
1072654612 10:97321077-97321099 CCTGGGCACGCACTGGGTTGCGG + Exonic
1073026439 10:100490211-100490233 CCTGGGCATGCCATGGGTAGAGG + Exonic
1073559765 10:104486851-104486873 CCTGGGCTTGCTGTGGGTTGGGG + Intergenic
1075370505 10:121930753-121930775 TCTGTGCAGGCACAGGGTTGGGG + Intergenic
1076243141 10:128925535-128925557 GCTGGGCTGGCACTGGGCTGGGG - Intergenic
1076333876 10:129692056-129692078 CCTGAGCACCCACTGGGTGCTGG - Intronic
1076789195 10:132767843-132767865 CCTGGGAACGCTGAGGGTTGGGG - Intronic
1079134743 11:17770122-17770144 CCAGGGCACCCCCTGGGTGGGGG + Intronic
1079844133 11:25442871-25442893 CCTGGGAAAACACTGAGTTGTGG + Intergenic
1080633735 11:34105364-34105386 CGTGGGCAGGCCCTGGGGTGCGG + Intergenic
1082002091 11:47398787-47398809 CCTGGGCATGCAAGGGGTTGGGG + Intergenic
1082110304 11:48266649-48266671 CCTGGGCATTGACTGGGTTAGGG + Intergenic
1084757324 11:71248087-71248109 CCAGGGCAGGCTCTGGGTAGTGG + Intronic
1085266645 11:75241427-75241449 CCAGGGCGCGCAGCGGGTTGTGG - Exonic
1089846724 11:121464614-121464636 CCAGGGCACGCAGGGGGCTGAGG + Intronic
1091011614 11:132006595-132006617 CCTAGGCACACACTGCTTTGTGG - Intronic
1092290769 12:7158380-7158402 CCTTAGCACTCACTGTGTTGGGG + Exonic
1092709522 12:11320199-11320221 CCTGGGCATGCTGTGGGGTGGGG + Intergenic
1096581757 12:52590276-52590298 CCTGAGCCCGATCTGGGTTGTGG + Intronic
1097478057 12:60083831-60083853 TCTGGGCACACACAGGGTTGAGG + Intergenic
1099972766 12:89516805-89516827 TCTAGGCACTCACTGGCTTGTGG + Intronic
1101950949 12:109174604-109174626 CCTCTGAAAGCACTGGGTTGGGG - Intronic
1102874847 12:116441499-116441521 CCTGGCCACCCACAGGGCTGAGG + Intergenic
1103070455 12:117936946-117936968 CCTGGGCACCCTCTGGGCTCTGG - Intronic
1103212390 12:119176401-119176423 CCTGGGCAGGGGCTGGGGTGAGG - Intergenic
1103851972 12:123939204-123939226 CCTAGGCAGGCCCTGGGTGGTGG - Intronic
1103863106 12:124029922-124029944 CCTGAGCTCCCCCTGGGTTGTGG + Intronic
1103972115 12:124678852-124678874 CCCGGGCACGGAGTGGGCTGGGG + Intergenic
1104584514 12:130037210-130037232 CCTGGGAGGGCACTGGGATGAGG + Intergenic
1106560938 13:30845725-30845747 CGTGGGGAAGCACTGGGTTGGGG + Intergenic
1119425651 14:74533299-74533321 CCAGGTCACCCACTGGTTTGGGG + Intronic
1121440431 14:93945433-93945455 CCTGAGCACACACTGGGTGCAGG + Intronic
1122413843 14:101539254-101539276 CCTGGGGATGCACTTGGTTGGGG - Intergenic
1122902110 14:104786260-104786282 CCTGGGAACCCACTGGGTGGAGG - Intronic
1129851458 15:78796294-78796316 CCCAGGCAAGCACAGGGTTGTGG + Intronic
1131775038 15:95785530-95785552 CCTCTGCAAGCACAGGGTTGGGG + Intergenic
1132282687 15:100633775-100633797 CCTGGGCCAGGACTAGGTTGAGG + Intronic
1132651147 16:1021939-1021961 GCTGGGCCCGCGCTGGGGTGTGG - Intergenic
1134057668 16:11180712-11180734 CCTGGTCACGCCTTGGGGTGGGG - Exonic
1139953651 16:70683513-70683535 GCTGGGCCAGCACTGGGTGGAGG + Intronic
1142042663 16:87905093-87905115 TCTGGGCAGGCGCTGGGCTGGGG - Intronic
1142328232 16:89432410-89432432 CCGTGGCATGCACTGTGTTGAGG + Intronic
1142603989 17:1071646-1071668 CCTGCACACGCAGTGGCTTGCGG - Intronic
1144058268 17:11559912-11559934 CCAGGGCACCCGCTGGGTTGGGG + Exonic
1144248578 17:13393421-13393443 CCTGGGCAGGCTCTGGGATGAGG + Intergenic
1144628743 17:16858842-16858864 CCAGGTCACACACTGTGTTGGGG - Intergenic
1144652664 17:17017248-17017270 CCAGGTCACACACTGTGTTGGGG + Intergenic
1145902386 17:28497217-28497239 GCTTGGCAGGCACTGGGCTGTGG - Exonic
1150240343 17:63626686-63626708 CCTGGGCATGGACAGGGTGGAGG + Intronic
1152070060 17:78129912-78129934 GCTGGGCACACAGTGGGCTGGGG - Intronic
1152252709 17:79220068-79220090 CCTGGGAAGGCACGGGGTGGGGG + Intronic
1152749146 17:82054564-82054586 CCTGGACACGGCCTGGGTGGAGG + Exonic
1152772956 17:82181334-82181356 CCAGGGCACGCAGTGGGGTCTGG + Intronic
1152854871 17:82658999-82659021 CCTGGGCCCTCCCTGGCTTGTGG - Intronic
1152906018 17:82971418-82971440 CATGGGCAAGCGCTGGGGTGGGG + Intronic
1153431752 18:5025043-5025065 CCATGGCATGCACAGGGTTGGGG - Intergenic
1155169544 18:23257126-23257148 CCTGAGCACTCACTGGCTGGTGG + Intronic
1156154653 18:34287549-34287571 CCAGGGCACACACTGGTATGAGG + Intergenic
1157685366 18:49638877-49638899 CCTGGGTAGGGACTGGGTTGGGG + Intergenic
1158407597 18:57174005-57174027 CCTGGGCACTCACAGGATTAGGG - Intergenic
1159928094 18:74286665-74286687 CATGGGAAAGCACTGGGCTGGGG - Intronic
1160317076 18:77858432-77858454 CCTGGGGACCCTCTGGGATGGGG + Intergenic
1160624260 18:80192406-80192428 CCTGGGCTCCCACTGGGCAGTGG - Intronic
1161040842 19:2110055-2110077 CCTGGACACCCACTGCGATGGGG + Intronic
1163889830 19:20000910-20000932 CCTTGGCCAGCACTGGGCTGTGG + Intronic
1165461235 19:35945368-35945390 TCTGAGCATGCCCTGGGTTGGGG + Exonic
1166014898 19:39972256-39972278 CCTGTGCAAGGTCTGGGTTGGGG - Intronic
1166448303 19:42877455-42877477 CCTGTGCTGGGACTGGGTTGTGG - Intronic
1166452707 19:42915667-42915689 CCTGTGCCAGGACTGGGTTGTGG - Intronic
1167748850 19:51368114-51368136 CCTGGCCACACACCGGGTTGGGG - Intronic
925171800 2:1754663-1754685 CCAGGGAACGCACTGGGTGGGGG - Intergenic
926296402 2:11572206-11572228 CCTGGGAAGGCACTGGATGGAGG + Intronic
927146505 2:20169633-20169655 CCTGTGGACCCACTGGGCTGGGG + Intergenic
929587450 2:43125449-43125471 CCTGGGGACTGACTGGGTGGGGG - Intergenic
930710866 2:54549991-54550013 CCTGGTCATGCACTTGTTTGAGG + Intronic
934461009 2:94213799-94213821 CCTGGGCAGGACCAGGGTTGGGG - Intergenic
934706831 2:96487322-96487344 CCTGGGAAAGGACTGGGATGGGG - Intergenic
935328841 2:101961859-101961881 CCTGGGGACCCACTAGGGTGGGG - Intergenic
936101150 2:109580877-109580899 CCTGGCCATTCACTGAGTTGAGG + Intronic
937200872 2:120203890-120203912 CCTGGGGTAGCACTGGGGTGAGG + Intergenic
942351539 2:175058042-175058064 TTTGGGCAGGCACTGCGTTGGGG + Intergenic
942947054 2:181683274-181683296 CCTGGACACGGCCTGGATTGAGG + Intergenic
945010981 2:205463357-205463379 CCTGGCCAGGCACTGCCTTGCGG + Intronic
947749279 2:232524285-232524307 CCTGGGGAGGCACAGGGTTAGGG - Exonic
948462967 2:238139088-238139110 CCTGGGCAGGCACTGGGGTGAGG + Intronic
948688379 2:239685986-239686008 CCTGAGCAAGCACTGGGAGGAGG + Intergenic
948930663 2:241129808-241129830 CCTGGGGCTGCCCTGGGTTGAGG - Intronic
1171012595 20:21516695-21516717 CCAGGGCAGCCACTAGGTTGGGG + Intergenic
1173340267 20:42147011-42147033 CCTGGGGATGCAGTGGGGTGAGG - Intronic
1173668641 20:44781802-44781824 CCTTGGAAGGAACTGGGTTGTGG + Intronic
1174136052 20:48380647-48380669 CCCAGGCACACCCTGGGTTGAGG - Intergenic
1175403211 20:58712215-58712237 CCTGGGCATGGGCTGGGCTGTGG - Intronic
1176106591 20:63392388-63392410 CCTGAGAAGGCACAGGGTTGCGG + Intergenic
1176164971 20:63668050-63668072 GCTGGGCACACACTGGGAGGAGG - Intronic
1178400760 21:32282883-32282905 CATGGGCATGCACTGGGATTTGG + Intergenic
1180154466 21:45971325-45971347 CCTGGGCACTCACTGAGTACTGG + Intergenic
1181029742 22:20143950-20143972 CCTGGGCACGCTCTGGGGACAGG + Intronic
1183149576 22:36027802-36027824 CCTGGGCACACGCTGGGATGGGG - Intronic
1183366605 22:37410356-37410378 CCTGGCCACTCACTGCGGTGTGG + Intronic
1183685906 22:39361300-39361322 CGGGGGCAGGCACTGGGGTGAGG + Intronic
1184767342 22:46578498-46578520 GCTGGGCTCGCCCTGGGTTGGGG + Intronic
1184991167 22:48170919-48170941 CCTGGGTAGGCGCTGGGTTTGGG + Intergenic
949520423 3:4847951-4847973 CCAGGGCAAGCACTGATTTGAGG - Intronic
954570371 3:51635999-51636021 CCAGGCCACACACTGGCTTGGGG + Intronic
968051812 3:195659508-195659530 ACTGGGCACCATCTGGGTTGGGG - Intergenic
968104002 3:195988827-195988849 ACTGGGCACCATCTGGGTTGGGG + Intergenic
968282691 3:197489288-197489310 CCTGGGCAGGAACTGTGCTGGGG - Intergenic
968302305 3:197626416-197626438 ACTGGGCACCATCTGGGTTGGGG + Intergenic
970511875 4:16789071-16789093 CCTGAGCACACACTGGTTGGGGG + Intronic
971419844 4:26465161-26465183 CCTGGGCAAACCCTGGGCTGAGG + Intergenic
973094891 4:46184132-46184154 ACTGGGCACTCATGGGGTTGGGG + Intergenic
981058131 4:140387369-140387391 CCTGTGCACACACTTGTTTGTGG - Intergenic
985868614 5:2536352-2536374 CCTGGGCACCCTCTGGGTCTGGG + Intergenic
986239870 5:5951398-5951420 CCTGTGGACACACTGGGCTGAGG + Intergenic
988984168 5:36600587-36600609 CCTGGGGAGGCAGTGGGATGAGG + Intergenic
991227683 5:64292148-64292170 CAAGGGCACGAACTGGGCTGAGG - Intronic
997929947 5:138064292-138064314 CCAGGCCAGGCACTGTGTTGAGG + Intergenic
999239830 5:150120999-150121021 TCTGTGGACGCACTGGGTTTGGG + Exonic
1000973302 5:167738097-167738119 GCTGGGCACCCACAGGGTTCTGG + Intronic
1002183475 5:177443143-177443165 CTTGGGTACCCACTGGGATGTGG + Intergenic
1002505399 5:179675865-179675887 ACAGGGCCCGCACTGGGCTGTGG + Intergenic
1002790976 6:437139-437161 TCTGGGCACGCATTGTGTGGTGG + Intergenic
1002828344 6:794435-794457 ACTGGACAGGCACGGGGTTGGGG + Intergenic
1006153167 6:32000226-32000248 CCTCTGCACACACTGGGTAGGGG - Intronic
1006159475 6:32032963-32032985 CCTCTGCACACACTGGGTAGGGG - Intronic
1006579432 6:35068344-35068366 CCTGGGGAAGCTCTGGGGTGGGG + Intronic
1011671017 6:89683118-89683140 GCTGGGCAGGTACTTGGTTGTGG - Exonic
1011692898 6:89886494-89886516 CCTGGACACGGCCTGGGTGGAGG + Intergenic
1018907273 6:168082900-168082922 CCTGGGGAAGAACTGGGGTGGGG - Intergenic
1019594304 7:1851282-1851304 CCTCGGCCGGCACAGGGTTGGGG + Intronic
1019666457 7:2254405-2254427 CCTGGGCACACACAGGGTCATGG + Exonic
1022509925 7:30928524-30928546 CCTGGCCACGCCATGGGTGGGGG - Intergenic
1023843834 7:44110337-44110359 CCTGGCCACGCACTGGATGCTGG - Exonic
1025106519 7:56175356-56175378 GCTGGGGTCGCAGTGGGTTGCGG + Intergenic
1030106124 7:105989070-105989092 CCTGGGCACCTTCTGTGTTGTGG + Intronic
1030609417 7:111672735-111672757 CCTAGGCACACCCTGGATTGGGG - Intergenic
1031947700 7:127858411-127858433 CTTGGGCACTCACTGGGGTCTGG + Intronic
1033644187 7:143288283-143288305 CCTGCGCACGCACCGGGCCGGGG + Exonic
1035315288 7:157993698-157993720 CCTGGACCCGTGCTGGGTTGGGG - Intronic
1037699624 8:21262779-21262801 TCTGGACAAGCAGTGGGTTGGGG + Intergenic
1038074547 8:24057100-24057122 CCTAGGCACACACAGGGTTGGGG - Intergenic
1039914942 8:41852795-41852817 CCAGGGCACTCAGCGGGTTGGGG - Intronic
1042130002 8:65579000-65579022 CCTGGGCAGGCAGTGTGGTGGGG + Intergenic
1043070213 8:75627391-75627413 CCAGGGAACCCTCTGGGTTGAGG - Intergenic
1049183670 8:141237377-141237399 CCTGGGCACAATCTGGGCTGTGG - Intronic
1049276771 8:141723893-141723915 TGTGGGCCCGGACTGGGTTGGGG - Intergenic
1049424923 8:142533697-142533719 CCTGCGCCCGCACTGGCTTGGGG + Intronic
1049539829 8:143203329-143203351 CCTGGGAATGCACTGAGTGGTGG - Intergenic
1052850935 9:33378103-33378125 CTGGGGTAGGCACTGGGTTGAGG + Intergenic
1059197097 9:112380297-112380319 CCTGGGCACGCTCTGAGCTCTGG + Intronic
1061878098 9:133554830-133554852 TCTGGGCAGGCACAGGGTTGAGG + Intronic
1062439171 9:136561975-136561997 CGCGGGCAAGCACTGGGTGGTGG - Intergenic
1062547200 9:137069165-137069187 CCAAGGCAGGCACTGGGTTGGGG + Intronic
1062688457 9:137828312-137828334 CCTGGACATGCCCTGGGGTGGGG + Intronic
1189992638 X:46609238-46609260 CCTGGGCATGAACTGTGATGTGG + Intronic
1200279016 X:154761339-154761361 CCTGGGCATGCAGTGGGCTGAGG - Intergenic
1202249297 Y:22853354-22853376 CCAGGGTGCGCACTGGGTAGTGG - Intergenic
1202402283 Y:24487102-24487124 CCAGGGTGCGCACTGGGTAGTGG - Intergenic
1202468497 Y:25182982-25183004 CCAGGGTGCGCACTGGGTAGTGG + Intergenic