ID: 1072656762

View in Genome Browser
Species Human (GRCh38)
Location 10:97335005-97335027
Sequence CCCAGGAGGCGGGCCCGGAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1072656762_1072656771 3 Left 1072656762 10:97335005-97335027 CCACTCCGGGCCCGCCTCCTGGG No data
Right 1072656771 10:97335031-97335053 CGGCCTCCCTCCCCACGTGTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1072656762 Original CRISPR CCCAGGAGGCGGGCCCGGAG TGG (reversed) Intergenic
No off target data available for this crispr