ID: 1072657055

View in Genome Browser
Species Human (GRCh38)
Location 10:97337128-97337150
Sequence CAGGAATGAGACTTGGATCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1072657055_1072657059 -6 Left 1072657055 10:97337128-97337150 CCTAGATCCAAGTCTCATTCCTG No data
Right 1072657059 10:97337145-97337167 TTCCTGCCACATCCTGGGTGTGG No data
1072657055_1072657063 3 Left 1072657055 10:97337128-97337150 CCTAGATCCAAGTCTCATTCCTG No data
Right 1072657063 10:97337154-97337176 CATCCTGGGTGTGGGACTCCAGG No data
1072657055_1072657060 -5 Left 1072657055 10:97337128-97337150 CCTAGATCCAAGTCTCATTCCTG No data
Right 1072657060 10:97337146-97337168 TCCTGCCACATCCTGGGTGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1072657055 Original CRISPR CAGGAATGAGACTTGGATCT AGG (reversed) Intergenic
No off target data available for this crispr