ID: 1072657059

View in Genome Browser
Species Human (GRCh38)
Location 10:97337145-97337167
Sequence TTCCTGCCACATCCTGGGTG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1072657055_1072657059 -6 Left 1072657055 10:97337128-97337150 CCTAGATCCAAGTCTCATTCCTG No data
Right 1072657059 10:97337145-97337167 TTCCTGCCACATCCTGGGTGTGG No data
1072657054_1072657059 15 Left 1072657054 10:97337107-97337129 CCAGAACAGGTTGTACAAAGACC No data
Right 1072657059 10:97337145-97337167 TTCCTGCCACATCCTGGGTGTGG No data
1072657053_1072657059 16 Left 1072657053 10:97337106-97337128 CCCAGAACAGGTTGTACAAAGAC No data
Right 1072657059 10:97337145-97337167 TTCCTGCCACATCCTGGGTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1072657059 Original CRISPR TTCCTGCCACATCCTGGGTG TGG Intergenic
No off target data available for this crispr