ID: 1072660291

View in Genome Browser
Species Human (GRCh38)
Location 10:97359810-97359832
Sequence CAGCTCACCTACTGTGCCCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 230
Summary {0: 1, 1: 0, 2: 4, 3: 45, 4: 180}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1072660291_1072660300 4 Left 1072660291 10:97359810-97359832 CCCAGGGCACAGTAGGTGAGCTG 0: 1
1: 0
2: 4
3: 45
4: 180
Right 1072660300 10:97359837-97359859 TGGCTCATGGGTGCCACAGGCGG No data
1072660291_1072660296 -8 Left 1072660291 10:97359810-97359832 CCCAGGGCACAGTAGGTGAGCTG 0: 1
1: 0
2: 4
3: 45
4: 180
Right 1072660296 10:97359825-97359847 GTGAGCTGGCCCTGGCTCATGGG No data
1072660291_1072660302 17 Left 1072660291 10:97359810-97359832 CCCAGGGCACAGTAGGTGAGCTG 0: 1
1: 0
2: 4
3: 45
4: 180
Right 1072660302 10:97359850-97359872 CCACAGGCGGAAGAGCCATGAGG No data
1072660291_1072660298 1 Left 1072660291 10:97359810-97359832 CCCAGGGCACAGTAGGTGAGCTG 0: 1
1: 0
2: 4
3: 45
4: 180
Right 1072660298 10:97359834-97359856 CCCTGGCTCATGGGTGCCACAGG No data
1072660291_1072660295 -9 Left 1072660291 10:97359810-97359832 CCCAGGGCACAGTAGGTGAGCTG 0: 1
1: 0
2: 4
3: 45
4: 180
Right 1072660295 10:97359824-97359846 GGTGAGCTGGCCCTGGCTCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1072660291 Original CRISPR CAGCTCACCTACTGTGCCCT GGG (reversed) Intronic
900608076 1:3532624-3532646 CCGCTCACCTATTGTCCTCTGGG - Intronic
901064363 1:6487866-6487888 AAGCGCACCTACTGTGCACCAGG - Intronic
901092805 1:6653508-6653530 CAGCTCTCATCCTGAGCCCTGGG - Intronic
901799718 1:11701057-11701079 CAGCTCTCCAACTCTCCCCTAGG + Intronic
902727995 1:18350119-18350141 CTGCTCACCCACTGTCCACTTGG + Intronic
904148204 1:28412956-28412978 CTGCTCACCTCCTGTGGCCCGGG - Intronic
904950792 1:34236974-34236996 CAGCTAAACTTCAGTGCCCTTGG - Intergenic
905164768 1:36073523-36073545 CAGCTCACCTCCTGGGCTCAAGG + Intergenic
905294961 1:36948470-36948492 CAGTGCACCTACTGTGTGCTAGG + Intronic
905629132 1:39509139-39509161 CAGCAGCCCTGCTGTGCCCTGGG + Intronic
906316049 1:44786957-44786979 CAGCTCCCCTGCAGTGCCCAGGG + Intronic
909602747 1:77478083-77478105 CAGCTCACCTCTTGTGCCATGGG + Intronic
911946545 1:104116392-104116414 CAGTTCACCTTCTGTGCTTTTGG - Intergenic
912953551 1:114136816-114136838 CAGCTCTCCTTCTGGGCACTCGG + Intronic
918339445 1:183555922-183555944 CTCCTCACCCACTGTGCCCCAGG + Exonic
924419719 1:243896871-243896893 CAGCTCACACACTCTTCCCTCGG - Intergenic
1067202341 10:44184417-44184439 CTGCCCACCTACTGTGACATTGG - Intergenic
1069587313 10:69616734-69616756 TCGCTCACCTACAGTTCCCTAGG + Intergenic
1070449750 10:76546183-76546205 CTGCATACCTACTGTGCCCTTGG + Intronic
1072629562 10:97135888-97135910 GAGCTGACACACTGTGCCCTGGG + Intronic
1072660291 10:97359810-97359832 CAGCTCACCTACTGTGCCCTGGG - Intronic
1072660579 10:97361248-97361270 CAGAGCACCTACTGTGCGCCTGG + Intronic
1074127470 10:110540682-110540704 CACCTCAGCTACTGTGGTCTCGG - Intergenic
1074875879 10:117613130-117613152 CAGCTCACCTACTCTGGTTTTGG + Intergenic
1075150099 10:119921096-119921118 CAGCTCCATTACTGTGCCCTAGG - Intronic
1075288020 10:121204023-121204045 CAGAGCACCTACTGTGCCCCAGG + Intergenic
1076038760 10:127225318-127225340 CAGACCCCCTCCTGTGCCCTTGG - Intronic
1076068672 10:127468791-127468813 CAGCTTATCTACTGTGACCTTGG + Intergenic
1076368222 10:129935805-129935827 CAGCCCACATTCTATGCCCTTGG - Intronic
1077185124 11:1232321-1232343 CGGCTCACCTGCTGCGCCTTGGG - Intronic
1077433107 11:2525844-2525866 CTGATCACCTACTGTGCACCAGG + Intronic
1078023328 11:7672977-7672999 GAGCTCAGCTCCTGTGCCTTTGG - Intronic
1082842171 11:57698734-57698756 CAGCTCAAAGCCTGTGCCCTGGG - Exonic
1083224204 11:61274277-61274299 CAGAGCACCTACTGTGTGCTGGG - Intronic
1089334559 11:117714160-117714182 CAGCACACTTACTATGCCCCAGG - Intronic
1089638408 11:119831454-119831476 CAGCCCACCTGCTGTCCTCTGGG - Intergenic
1089644633 11:119870602-119870624 CAGGTCACCCACTGTCCCCATGG + Intergenic
1091849196 12:3681432-3681454 CAGCTCAGCTGCTTTGCTCTTGG - Intronic
1095160215 12:38906172-38906194 CGTCCCTCCTACTGTGCCCTCGG + Intronic
1095181760 12:39154357-39154379 CAGCTCAGCTACTGTGGGATAGG - Intergenic
1096110642 12:49027166-49027188 CAGTCCCCCTACTGAGCCCTTGG - Exonic
1097196381 12:57244401-57244423 CAGGTCCCCTGCTGTGCCCCGGG + Intronic
1098596261 12:72275119-72275141 CTGCTCACCTCCAGGGCCCTGGG - Intronic
1099931892 12:89084674-89084696 CTTCTAGCCTACTGTGCCCTTGG - Intergenic
1100743516 12:97620724-97620746 AGGCACACCTGCTGTGCCCTGGG - Intergenic
1102879070 12:116470349-116470371 CAGAGCACCTACTGTGCACTGGG - Intergenic
1103942907 12:124510602-124510624 CAGCTCACCCACTGTGTCCTGGG + Intronic
1105700842 13:22935027-22935049 CAGCTCACCTACCTGTCCCTCGG + Intergenic
1111587022 13:90293969-90293991 CTGTTCACTTACTGTGACCTAGG - Intergenic
1112362685 13:98731248-98731270 CAGCGCACCTGCTGTGGACTTGG + Intronic
1112623123 13:101072628-101072650 CAGCACTCCTACTGTGTGCTAGG + Intronic
1114492357 14:23111249-23111271 CATCTCACCTTCTCTGCCTTAGG + Intergenic
1115267944 14:31520940-31520962 TAGCGCACCTGCTGTGGCCTAGG + Intronic
1115309671 14:31966536-31966558 CAGCTCACATACTTTCCCTTTGG + Intergenic
1120999009 14:90437943-90437965 AAGATCACCTACTGTGAGCTTGG - Intergenic
1121261879 14:92572388-92572410 CATCTCACAAACTGTGCCCGTGG - Intronic
1124666130 15:31594559-31594581 CAGCTCTCTAACTGTGCTCTGGG - Intronic
1128725956 15:69988778-69988800 CAGCCCTCCTGCTGTGCCCTGGG - Intergenic
1132642372 16:983676-983698 CAGGGCGCCCACTGTGCCCTCGG - Intronic
1132722511 16:1323739-1323761 CAGCTGAGCTGCTCTGCCCTGGG + Intronic
1134050917 16:11136792-11136814 CAGCACACATCCTGTCCCCTGGG + Intronic
1134350918 16:13437083-13437105 CAGCTCCCGTAATGTGCCATGGG - Intergenic
1134814059 16:17191573-17191595 CTGCACACCTACTGTGTGCTGGG - Intronic
1139395481 16:66635433-66635455 CTGCTCTCCTGGTGTGCCCTGGG - Intronic
1140194641 16:72846339-72846361 CAGCCCTCCTTCTGTGCCCTGGG - Intronic
1140374173 16:74431547-74431569 CAGCTCTCCTCCTGGCCCCTGGG + Intergenic
1141179022 16:81739707-81739729 CCTCTCACCAACTGTGACCTTGG + Intronic
1141860375 16:86712318-86712340 CAGCTCACCTGCCCTGCCCCTGG + Intergenic
1142289396 16:89185865-89185887 CAGAGCACCTACTGTGCGCTGGG - Intronic
1142289404 16:89185959-89185981 CAGAGCACCTACTCTGCGCTGGG - Intronic
1142289408 16:89185992-89186014 CAGAGCACCTACTCTGCGCTGGG - Intronic
1142289411 16:89186025-89186047 CAGAGCACCTACTGTGCGCTGGG - Intronic
1142289417 16:89186086-89186108 CAGAGCACCTACTGTGCGCTGGG - Intronic
1142289421 16:89186119-89186141 CAGAGCACCTACTGTGCGCTGGG - Intronic
1142289424 16:89186152-89186174 CAGAGCACCTACTGTGTGCTGGG - Intronic
1142289427 16:89186185-89186207 CAGAGCACCTACTGTGCGCTGGG - Intronic
1142289430 16:89186214-89186236 CAGAGCACCTACTGTGCGCTGGG - Intronic
1142289433 16:89186247-89186269 CAGAGCACCTACTGTGCACTGGG - Intronic
1142289436 16:89186280-89186302 CAGAGCACCTACTGTGCGCTGGG - Intronic
1142289439 16:89186313-89186335 CAGAGCACCTACTGTGCGCTGGG - Intronic
1142289443 16:89186346-89186368 CAGAGCACCTTCTGTGCGCTGGG - Intronic
1142289447 16:89186379-89186401 CAGAGCACCTACTGTGCGCTGGG - Intronic
1142289450 16:89186412-89186434 CAGAGCACCTACTGTGCGCTGGG - Intronic
1142289454 16:89186445-89186467 CAGAGCACCTTCTGTGCGCTGGG - Intronic
1142289460 16:89186478-89186500 CAGAGCACCTACTGTGCGCTGGG - Intronic
1142289463 16:89186511-89186533 CAGAGCACCTACTGTGCGCTGGG - Intronic
1142289466 16:89186544-89186566 CAGAGCACCTACTGTGCGCTGGG - Intronic
1142289469 16:89186573-89186595 CAGAGCACCTACTGTGCGCTGGG - Intronic
1142289472 16:89186606-89186628 CAGAGCACCTACTGTGCGCTGGG - Intronic
1142289475 16:89186639-89186661 CAGAGCACCTACTGTGCGCTGGG - Intronic
1142289478 16:89186672-89186694 CAGAGCACCTACTGTGCGCTGGG - Intronic
1142289481 16:89186701-89186723 CAGAGCACCTACTGTGCGCTGGG - Intronic
1142289484 16:89186734-89186756 CAGAGCACCTTCTGTGCGCTGGG - Intronic
1142289487 16:89186767-89186789 CAGAGCACCTACTGTGCTCTGGG - Intronic
1142289490 16:89186800-89186822 CAGAGCACCTTCTGTGCGCTGGG - Intronic
1142289493 16:89186833-89186855 CAGAGCACCTTCTGTGCGCTGGG - Intronic
1142289496 16:89186866-89186888 CAGAGCACCTACTGTGCGCTGGG - Intronic
1142289499 16:89186895-89186917 CAGAGCACCTACTGTGTGCTGGG - Intronic
1142289502 16:89186928-89186950 CAGAGCACCTACTGTGTGCTGGG - Intronic
1142289505 16:89186961-89186983 CAGAGCACCTACTGTGTGCTGGG - Intronic
1142289508 16:89186994-89187016 CAGAGCACCTACTGTGCGCTGGG - Intronic
1142289511 16:89187027-89187049 CAGAGCACCTACTGTGCACTGGG - Intronic
1142289523 16:89187126-89187148 CAGAGCACCTACTCTGCACTGGG - Intronic
1142289526 16:89187159-89187181 CAGAGCACCTACTGTGCGCTGGG - Intronic
1142289529 16:89187192-89187214 CAGAACACCTACTGTGCACTGGG - Intronic
1142428965 16:90016219-90016241 CTGCGCACCTACTGTGCGCTAGG - Intronic
1142919201 17:3169785-3169807 CAGCTCAGCCACAGTGCCCAGGG + Intergenic
1144278289 17:13698804-13698826 CAGCAGAACTACTGTGCTCTGGG + Intergenic
1146643274 17:34556983-34557005 CAGCTCTCCTGCTGCTCCCTGGG - Intergenic
1147847869 17:43417896-43417918 CATCTCAGCTGCTGTGCCCCAGG - Intergenic
1150039134 17:61839985-61840007 AAGCACATCTACTGTGCCCTTGG - Intronic
1151858581 17:76740746-76740768 AAGCCCACCAACTGTGCCTTGGG - Intronic
1153577308 18:6535664-6535686 CAGCTCACCCAGTGGGCCCCTGG - Intronic
1155185422 18:23383139-23383161 CAGCTCCCCTGCAGAGCCCTGGG - Intronic
1158664223 18:59417997-59418019 CTGTTCACCTACTGTGTTCTAGG + Intergenic
1160131799 18:76231818-76231840 CTGCTCACCCTCTGTGGCCTCGG + Intergenic
1160622765 18:80182110-80182132 CTGCTCACCCACAGTGCTCTGGG + Intronic
1161531898 19:4794620-4794642 CAGCTCACTCCCTGTGCCCTCGG - Exonic
1161802968 19:6425968-6425990 CAGCTCCCCTACTGGGTCCAGGG + Intergenic
1162045028 19:7993421-7993443 CAGCTCACTCACTGTGTCTTTGG - Intronic
1163167826 19:15509636-15509658 CAGCTCTCCCACTGGGCACTGGG - Intronic
1164480119 19:28605073-28605095 CAGCTCACAGACTGTTCCTTCGG + Intergenic
1164972892 19:32547703-32547725 CATCTCCCCTACTCTGCCCTAGG + Intergenic
1167075409 19:47245568-47245590 GAGTTCACCTACTGTGTGCTAGG + Intergenic
1168414478 19:56159789-56159811 CAGCTCACCTGCTGCGCCACCGG + Exonic
925309203 2:2870295-2870317 CAGGGCACCTGCTGTGGCCTGGG - Intergenic
925346602 2:3176223-3176245 AAGCTCACCGACAGAGCCCTGGG - Intergenic
925792667 2:7508338-7508360 CGGCTCACCTACTGCCTCCTGGG - Intergenic
933669346 2:84992095-84992117 CTGGTCACTTACTGTGACCTTGG + Intronic
936074550 2:109393515-109393537 CTGAGCACCTACTGTGTCCTGGG - Intronic
936636205 2:114261529-114261551 CACCTCACCAACTCTGCCCCAGG + Intergenic
937925759 2:127166267-127166289 CAGCTCTCCTTCTGTGGCCCTGG - Intergenic
940383688 2:153045928-153045950 CAGCTCACTAACTGTGCCATGGG - Intergenic
942040220 2:172054089-172054111 CATTTCACCCACTGAGCCCTGGG - Intronic
943615803 2:190090735-190090757 CAGCTCACACACTTTTCCCTGGG - Intronic
945042855 2:205756561-205756583 CAGTGTAGCTACTGTGCCCTTGG - Intronic
945504456 2:210621125-210621147 CAGCTTCCCTACCATGCCCTTGG - Intronic
1172390078 20:34560035-34560057 CAACCCACCTACTCTGCCCCTGG + Exonic
1175836533 20:61999495-61999517 CACCTCACCCAGTGTGCCCTTGG + Intronic
1179557576 21:42190271-42190293 CATCTCACCTCCTCGGCCCTGGG + Intergenic
1179730297 21:43363851-43363873 CAGCTCAGCTGCTGGGCCCTGGG + Intergenic
1180985741 22:19903124-19903146 CAGCCCACACACTGGGCCCTGGG - Intronic
1183307206 22:37089090-37089112 CTGCACACCTACTGTGCGTTTGG + Intronic
1183729970 22:39612867-39612889 CAGAACACCTACTGTGTGCTAGG + Intronic
950264999 3:11567027-11567049 CAGCTCACCGACTGGGCCGCAGG - Intronic
950491064 3:13305402-13305424 CCTCTCATCCACTGTGCCCTGGG - Intergenic
950635483 3:14311427-14311449 AAGCTCACCTCCTGTCCCCGTGG - Intergenic
951262157 3:20523239-20523261 CAGCAGAGCTACTGGGCCCTGGG + Intergenic
952122782 3:30264460-30264482 CAGCACAGCTACTGGGCTCTGGG - Intergenic
952885744 3:38010062-38010084 CACCACTCCTAATGTGCCCTTGG - Intronic
956304176 3:67805725-67805747 CAGCCCTCCTACTGGGCACTGGG + Intergenic
958859188 3:99424626-99424648 CAGCTCACTTAGTGAGCACTAGG - Intergenic
961618543 3:128204730-128204752 CAGCACACTTACCATGCCCTGGG - Intronic
963065291 3:141258985-141259007 AAAGTCACCTACTGGGCCCTTGG + Intronic
968462984 4:735043-735065 CACCCCACGTACTGTGGCCTGGG - Intronic
968493201 4:901419-901441 CAGCTCTCCCCGTGTGCCCTAGG - Intronic
968948929 4:3680233-3680255 CTGCACACCCACTGTGCTCTAGG - Intergenic
969455077 4:7295862-7295884 CTGATCACCTACTGTGTGCTGGG - Intronic
969931645 4:10636667-10636689 CAGCTCTCATACCGTGCACTTGG + Intronic
970482416 4:16489932-16489954 AAGCTCCCCTACTGTGACCTGGG + Intergenic
971616057 4:28791830-28791852 CTTCTCACCTACTGGTCCCTAGG + Intergenic
973803058 4:54497630-54497652 CAGCACACCAGCTGTGGCCTTGG - Intergenic
975715551 4:77202462-77202484 CATCTCAACTACTCTGTCCTTGG + Intronic
978891838 4:113838546-113838568 CAGCTCACCCACTGAGCACAGGG - Intergenic
982057984 4:151572260-151572282 CAGCTCTCTTACTGTGTGCTTGG + Intronic
982240563 4:153295656-153295678 CAGCTCACCGTCTTTGTCCTTGG - Exonic
982780034 4:159481056-159481078 CACTTCACATACTGTGCCCCAGG - Intergenic
985037900 4:185859731-185859753 TAGGTCACCCATTGTGCCCTGGG - Intronic
988429670 5:31104867-31104889 CAGATCACCAGTTGTGCCCTTGG + Intergenic
989682568 5:44046588-44046610 CAGCACACCTACTCTGCCAAGGG - Intergenic
990297069 5:54412962-54412984 CAGCTTCCCTGCTGCGCCCTGGG - Intergenic
996576368 5:124980648-124980670 CAGCACCCCTGCTGTGCCCTGGG - Intergenic
997210774 5:132075446-132075468 CAGCTGCCCTGCTCTGCCCTGGG + Intronic
997698135 5:135877783-135877805 CCCCTCACCTTCTGTGCACTTGG - Intronic
999445003 5:151632279-151632301 CATCTCTCCCACTGTGTCCTTGG - Intergenic
1001312740 5:170623134-170623156 CAGCTCACCTGCTGTGCAGCCGG + Intronic
1001587478 5:172843349-172843371 CACCTCACCAGCTGTGTCCTGGG - Intronic
1001820390 5:174705605-174705627 CACCTTACCATCTGTGCCCTGGG - Intergenic
1002089725 5:176797466-176797488 CAGCTCACACCCTGTGGCCTCGG + Intergenic
1002493959 5:179599407-179599429 CACCTCAGCCACTGTGCCCAGGG + Intronic
1003181094 6:3792344-3792366 CAGCTCACCTACTGTGGACTAGG + Intergenic
1005326433 6:24706177-24706199 CAGCTCACCCACTGGGCAGTTGG - Exonic
1007030134 6:38619636-38619658 CATCACACTTACTGAGCCCTGGG + Intronic
1007975834 6:46100405-46100427 CAGCTCCCTGACTTTGCCCTGGG + Intergenic
1008595923 6:53041716-53041738 CAGTTCACCTAGTGTGCACCTGG - Intronic
1009446726 6:63751338-63751360 CAGCTCTTCTACTGTACCATAGG + Intronic
1011809297 6:91111969-91111991 CTTCTCACTTACTGTGCCTTTGG + Intergenic
1013191878 6:107810513-107810535 CAGATCATCTCCTCTGCCCTGGG + Intronic
1015490126 6:133815454-133815476 TCCCTCACCTTCTGTGCCCTGGG + Intergenic
1018270367 6:162070909-162070931 GAAAGCACCTACTGTGCCCTAGG - Intronic
1018347712 6:162919968-162919990 CAGTGGACCTACTGTGCTCTGGG - Intronic
1021842066 7:24728815-24728837 AACCTCAACTCCTGTGCCCTGGG + Intronic
1023208065 7:37772630-37772652 CAGCTCCCTTCCTGTGCTCTGGG + Intronic
1023473116 7:40546714-40546736 CAGCTGGGCTACTATGCCCTGGG - Intronic
1023849507 7:44142207-44142229 CAGCCCCTCTGCTGTGCCCTCGG - Intergenic
1023907250 7:44531531-44531553 CATCTCTCTTACTGTGGCCTGGG + Intronic
1024057331 7:45670365-45670387 CAGCTCACCTGCTGTGTCCTGGG - Intronic
1024549531 7:50550689-50550711 TATCTCACCTACCGTGACCTGGG - Intronic
1025255521 7:57381798-57381820 CTGCTCACCTAAGGGGCCCTGGG - Intergenic
1028596680 7:92553519-92553541 GAGCTCAACTTCTATGCCCTAGG + Intergenic
1029563004 7:101316220-101316242 CTGAGCACCTACTGTACCCTAGG - Intronic
1034939716 7:155222692-155222714 AACCCCACCTACTGTCCCCTGGG + Intergenic
1035443179 7:158921006-158921028 CAGCTCCCCGACAGTGCCCAGGG - Intronic
1035459877 7:159032088-159032110 CAGCTCAGCTGCTGGACCCTCGG + Intronic
1036969464 8:13338739-13338761 TAGCTCACCTCCTGTGATCTGGG - Intronic
1040512114 8:48105095-48105117 CAGCAGACCTTCTGTGCCCCAGG + Intergenic
1040546515 8:48402157-48402179 CAGGTCACTTAATGGGCCCTTGG - Intergenic
1041003016 8:53470209-53470231 CAGCTCACCTTTTCTGCCCTGGG + Intergenic
1048469881 8:134696445-134696467 CATCCCTCCTACTCTGCCCTTGG - Intronic
1048991815 8:139764980-139765002 CTGAAGACCTACTGTGCCCTGGG - Intronic
1049305218 8:141899273-141899295 CAGCTCAAATCCTGTGTCCTGGG - Intergenic
1049373581 8:142278946-142278968 CAGGTCACCTGCTGCTCCCTGGG + Intronic
1049750304 8:144279936-144279958 CAGCTCACATCCTGTGCTCTGGG - Intronic
1052044914 9:23782865-23782887 CAGCTCACTTCTTGTGCCCCGGG - Intronic
1052244690 9:26320247-26320269 CAGCTTTCCTAATGTGCCTTGGG + Intergenic
1053142058 9:35688635-35688657 CAGCAGCCCTGCTGTGCCCTGGG - Intronic
1055442185 9:76347521-76347543 AAGCTGACATACAGTGCCCTTGG + Intronic
1057303015 9:93897226-93897248 CAGCTCACCTCGAGGGCCCTGGG - Intergenic
1057551454 9:96053827-96053849 CAGCTCACCTGCTGTGGCCTGGG - Intergenic
1058112132 9:101042348-101042370 CATCTCAGCAACTGTCCCCTTGG - Intronic
1058957591 9:109963587-109963609 CAGCCCCCATACTGGGCCCTGGG + Intronic
1060230673 9:121822914-121822936 CAGCTGCCCTACGCTGCCCTGGG + Intronic
1187525219 X:20048028-20048050 CAGCTCACCCACTTGACCCTTGG - Intronic
1191888861 X:65920159-65920181 CAGCATAGCTACTGTGCTCTGGG + Intergenic
1191976646 X:66879047-66879069 CAACTCTCCAACTGTGGCCTGGG + Intergenic
1195727672 X:107934974-107934996 CAAGTGACCTACTCTGCCCTTGG - Intergenic
1196018616 X:110965756-110965778 CAGAGCACCTACTGTGGACTAGG + Intronic
1199760767 X:150902452-150902474 AAGGTCACCTTCTGTGCCCTGGG + Intergenic
1201756736 Y:17494385-17494407 CAGCACACCTACTCTGCCAAGGG + Intergenic
1201844817 Y:18411599-18411621 CAGCACACCTACTCTGCCAAGGG - Intergenic