ID: 1072664636

View in Genome Browser
Species Human (GRCh38)
Location 10:97384517-97384539
Sequence CATCCTGGCTGCTGAGGTTA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 263
Summary {0: 2, 1: 1, 2: 5, 3: 21, 4: 234}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1072664636_1072664641 11 Left 1072664636 10:97384517-97384539 CCATAACCTCAGCAGCCAGGATG 0: 2
1: 1
2: 5
3: 21
4: 234
Right 1072664641 10:97384551-97384573 TACCCCCAACCTCAGCTGCCTGG No data
1072664636_1072664648 26 Left 1072664636 10:97384517-97384539 CCATAACCTCAGCAGCCAGGATG 0: 2
1: 1
2: 5
3: 21
4: 234
Right 1072664648 10:97384566-97384588 CTGCCTGGACGGAGACCCTGAGG No data
1072664636_1072664645 15 Left 1072664636 10:97384517-97384539 CCATAACCTCAGCAGCCAGGATG 0: 2
1: 1
2: 5
3: 21
4: 234
Right 1072664645 10:97384555-97384577 CCCAACCTCAGCTGCCTGGACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1072664636 Original CRISPR CATCCTGGCTGCTGAGGTTA TGG (reversed) Intronic
901434738 1:9240347-9240369 CTGCCTGGCTGCAGAGGTCAAGG + Intronic
901764253 1:11489909-11489931 CTTCCTGGCTGATGAGCTCAGGG - Intronic
902657607 1:17880149-17880171 CATCCTGGGTGCTTGGCTTATGG - Intergenic
902745858 1:18473862-18473884 CAGCCAGGCTGCTGGGGTTGGGG + Intergenic
902796747 1:18805239-18805261 GATCCTCGGTGCTGAGCTTAGGG + Intergenic
903301855 1:22384964-22384986 CATACTGGCTGCTGAGGTCCAGG + Intergenic
903970687 1:27116999-27117021 CCACCTGTCTGCTCAGGTTAGGG + Intronic
903993644 1:27290926-27290948 CATTCTGTCTTCTGAGGTTCAGG - Intronic
905796266 1:40818320-40818342 CACCCTGGCTCCTGGGGTCAGGG - Intronic
906215190 1:44034399-44034421 CTTCCTGGCTACTGAGGCTGGGG - Intergenic
908591959 1:65645368-65645390 AAGCCTGGCTGCTGCGGTTCAGG + Intergenic
908852399 1:68388483-68388505 AAGCCTGGCTGCTGTGGTTCAGG - Intergenic
909792982 1:79699836-79699858 ACTCCTGGCTGCTGTGGTTCAGG + Intergenic
913451394 1:118994986-118995008 CCTCCAGGCTGCCGAGGTCAGGG + Intergenic
915304292 1:154969009-154969031 CTTCCTGGCTGATTGGGTTAGGG + Intronic
917971684 1:180211955-180211977 CACCCTGGCTGCTCAGTTAATGG + Intergenic
918025031 1:180734889-180734911 CATCCTTGCTGCTAAGGCAATGG - Intronic
918078373 1:181187802-181187824 CGTCCTGGATTCTGAGGTGAGGG - Intergenic
918302803 1:183219287-183219309 GTTTCTGGCTGCTGAGGTGAAGG + Intronic
918362213 1:183771047-183771069 TATCCTGGCTGCTCAGCTGATGG + Intronic
920312980 1:205059277-205059299 CAACCTGGCTGCTGAAGGTCAGG + Exonic
921577063 1:216847756-216847778 CATCATGACTGCTGAGCTGAGGG + Intronic
922149573 1:222986770-222986792 TGTACTAGCTGCTGAGGTTAGGG - Intronic
922466640 1:225849168-225849190 CATCCTTGCTGCTGGAGTTGAGG - Intronic
924148051 1:241097626-241097648 CCTCCTCGCTGCTGAGGCTTCGG + Intronic
1062909929 10:1205816-1205838 CATCCTGACTGCTGACGTTTGGG + Intronic
1064320785 10:14302789-14302811 CATCCTGACTGCTGATGGTCAGG + Intronic
1068179660 10:53502527-53502549 GAGCCTGGCTGCTGCGGTTCAGG + Intergenic
1071674389 10:87641054-87641076 CATGCTGGCAGCTGATTTTATGG + Intergenic
1071766274 10:88669244-88669266 AAACCTGGCTGCTGATGCTAAGG + Intronic
1072664519 10:97384107-97384129 CGTCCTGGCTGCTGAGGTTGGGG - Intronic
1072664530 10:97384144-97384166 TGGCCTGGCTGCTGAGGTTGGGG - Intronic
1072664540 10:97384181-97384203 CATCCTGGCTGCTGAGGTTGGGG - Intronic
1072664568 10:97384291-97384313 CGTCCTGGCTGCTGAGGTTGTGG - Intronic
1072664578 10:97384328-97384350 CCTCCAGGCTGCAGAGGTTGGGG - Intronic
1072664604 10:97384404-97384426 CATCCTGGCTGCCAAGGTTGGGG - Intronic
1072664636 10:97384517-97384539 CATCCTGGCTGCTGAGGTTATGG - Intronic
1072664643 10:97384554-97384576 CGTCCAGGCAGCTGAGGTTGGGG - Intronic
1072664655 10:97384591-97384613 CGTCCTGGCTGCCGAGGTTGGGG - Intronic
1072664673 10:97384666-97384688 CATCCTGGCTGCTGAGGTTATGG - Intronic
1072664691 10:97384740-97384762 CATCCTGGCTGCCGAGGTTGGGG - Intronic
1072664741 10:97384926-97384948 CATCCTGGCTGCCAAGGTTGGGG - Intronic
1072664778 10:97385039-97385061 CATCCTGGCTGCCAAGGTTGGGG - Intronic
1073394676 10:103208076-103208098 CATCATGGATGCTGAGCTTTGGG + Intergenic
1075239551 10:120765459-120765481 CATCCTGGCTGATGAGGGGGTGG - Intergenic
1076362632 10:129900322-129900344 CATCCTGACAGCTTAGGTGATGG - Intronic
1077199312 11:1297501-1297523 CATGCTGGCTGCTCAGGTTGGGG - Intronic
1077865636 11:6218993-6219015 CATCCTCACAGCTGAGGTTCAGG + Exonic
1077934974 11:6773965-6773987 CATTCTGGGAGCTGAGTTTATGG + Intergenic
1078671622 11:13370721-13370743 CATCCTGGCTGCTGTGTTGGGGG - Intronic
1079607859 11:22392225-22392247 CATGCTGGCAGCTGAGGGGATGG - Intergenic
1080648821 11:34206833-34206855 CCTCCTGGCTGATGTGGTGAAGG + Intronic
1080786193 11:35477412-35477434 CTTCCTGGCATCTGAGTTTAGGG - Intronic
1082773812 11:57230551-57230573 CATCCTGGCTTCTGAAGTTGGGG + Intergenic
1083484563 11:62975230-62975252 CAGGCTGGCTGCTGGGGATAGGG + Intronic
1085217998 11:74849078-74849100 CCTCCTGGCAGCTGAGGCTGAGG - Intronic
1092223028 12:6728290-6728312 CACCCTGGCTGCTAAAGTAAAGG + Exonic
1093302234 12:17471794-17471816 GATCCTGGCTGCTGCGGTCTAGG - Intergenic
1094208030 12:27861142-27861164 CATCCTGAGTTCTGAGTTTAAGG - Intergenic
1096505997 12:52093712-52093734 AATGCTGGCTTCTGTGGTTATGG + Intergenic
1096837784 12:54362092-54362114 GATCCTGGCAGCAGTGGTTAGGG + Intergenic
1096919616 12:55069772-55069794 CATCCTGGATGCAGTGGTCAGGG - Intergenic
1097719692 12:63006627-63006649 CATCCTGTCAGCAGGGGTTAGGG + Intergenic
1101132401 12:101702909-101702931 CACCATGGCTGCAGAAGTTAAGG - Intronic
1101164071 12:102010097-102010119 AATCCTGGCAGCTGAGGACATGG - Intronic
1102138049 12:110591741-110591763 CCGCCTGCCTGCTGAGGTCAAGG - Intergenic
1102929794 12:116853474-116853496 CATCCGGGCTGCTGAGACTCGGG + Intronic
1103342997 12:120230982-120231004 CATTCTAGCTGCTGGGGATATGG - Intronic
1104788280 12:131465892-131465914 CCTTCTGGCAGCTGAGTTTATGG + Intergenic
1105032270 12:132892219-132892241 CATCATGGATGCTGAGCTTCGGG + Intronic
1105247709 13:18667505-18667527 CATCCTGTCTGCCTGGGTTACGG + Intergenic
1108437238 13:50412618-50412640 TGTCCTGACTCCTGAGGTTAAGG + Intronic
1108776250 13:53768685-53768707 CATGCTGAGTGCTTAGGTTAAGG + Intergenic
1111429894 13:88136541-88136563 CAGGCTGGCTGCTGAGGGAATGG - Intergenic
1112788365 13:102976614-102976636 CATCCTGGCTGCCAAGGAAAGGG - Intergenic
1113564726 13:111313086-111313108 GATCCTGGCTCCTGTGATTATGG - Intergenic
1114164472 14:20205496-20205518 CATCCCAGCTACTGAGGTTAAGG + Intergenic
1115395754 14:32906750-32906772 CATCTTGGAAGCTGAGGTGAGGG - Intergenic
1119836132 14:77750480-77750502 CATCATGGCTGCTGAGCTTTGGG - Intronic
1120941157 14:89951117-89951139 TATGCTGGCTATTGAGGTTATGG - Intronic
1122344102 14:101047535-101047557 CCTCCAGGGTTCTGAGGTTAGGG - Intergenic
1122345351 14:101055212-101055234 CATCCTTGCTGCTGGGGAGAAGG + Intergenic
1123044250 14:105503629-105503651 GATGCTGGCTGCAGAGGTTTGGG + Intergenic
1126203376 15:46014896-46014918 CATCCTTGCTGCTGAGATTAGGG + Intergenic
1127785053 15:62348393-62348415 TATCCTGCCTGCTGTGTTTAGGG - Intergenic
1128479085 15:68022058-68022080 AATCCAGGATGCTGAGGGTAAGG - Intergenic
1128956133 15:71947665-71947687 CATCCTGATACCTGAGGTTAGGG + Intronic
1129694318 15:77731920-77731942 TATCCAGGCTGCTGTGGTTGTGG - Intronic
1129960731 15:79681836-79681858 AACCCTGCATGCTGAGGTTATGG + Intergenic
1130460665 15:84156649-84156671 CGGCCAGGCTGCTGAGGTGATGG - Intergenic
1131684704 15:94756696-94756718 AATCCTGGCCGCTGCGGTTGAGG - Intergenic
1132640427 16:975821-975843 CATCCTGGCCGGGGAGGTCAGGG + Intronic
1133109666 16:3540231-3540253 CATCATGGATGCTGAGGCCATGG - Intronic
1133217102 16:4299281-4299303 CAGCCAGGCTGCTGAGGGTGTGG - Intergenic
1133264416 16:4574846-4574868 GGTCCTGGGTGCTGAGGGTAGGG + Intronic
1133833211 16:9343136-9343158 TATCCTGGCTTTTGAGGTTGAGG + Intergenic
1133837864 16:9382376-9382398 CATCTTGGTTGCTGAGTTTGAGG - Intergenic
1136730593 16:32408272-32408294 CATGCTGGCAGCTGATTTTATGG - Intergenic
1138552019 16:57753416-57753438 CATCCTCGCTGCTGGGGCTGCGG - Exonic
1139673062 16:68504911-68504933 CATTCTGGCTGCTGAGAGAAAGG + Intergenic
1142188297 16:88705313-88705335 CATCCAAGCTGCTGAGGTGGTGG - Intronic
1202995808 16_KI270728v1_random:109043-109065 CATGCTGGCAGCTGATTTTATGG + Intergenic
1203022495 16_KI270728v1_random:421385-421407 CATGCTGGCAGCTGATTTTATGG + Intergenic
1143282831 17:5767492-5767514 CAGCCTGGCTACTGAGGCAAAGG + Intergenic
1143285835 17:5788709-5788731 CATGCTGGGTGCTGAAGATAAGG - Intronic
1144076622 17:11725258-11725280 CATCCTGTCTGAGGAGGTGATGG - Intronic
1144904016 17:18625348-18625370 CCTCCTGGCTCCTGACGCTACGG + Intergenic
1146612684 17:34321584-34321606 AATCAGGGCTGCTGAAGTTAGGG - Intergenic
1146859403 17:36284007-36284029 AATCCGGGAGGCTGAGGTTACGG - Intronic
1148031275 17:44622808-44622830 AATTCTGGCTGCTGAGGTGGGGG + Intergenic
1148136142 17:45293145-45293167 CATCCTGTCTCCAAAGGTTATGG - Intronic
1148205546 17:45777521-45777543 CATCCTGTCTGAAGAGGCTAGGG - Intergenic
1148687867 17:49510614-49510636 CATCCTGGCTGCTGTGGTTGTGG + Exonic
1149453418 17:56767784-56767806 CAGCCTGGCTCCTGAAGTCAGGG + Intergenic
1149470172 17:56909901-56909923 AATACTGGCTGCTGCTGTTATGG - Intronic
1151151697 17:72093695-72093717 CATGCAGTCTTCTGAGGTTAGGG + Intergenic
1151170514 17:72241882-72241904 CATTTTGGCTGCTGAGTTTGAGG - Intergenic
1153742384 18:8142239-8142261 CATCATGGCTGCTGCTGTTGCGG + Intronic
1154441133 18:14391614-14391636 CATCCTGTCTGCCTGGGTTACGG - Intergenic
1158654478 18:59318111-59318133 CATAGTAGCTGCTGATGTTAGGG + Intronic
1160251156 18:77204525-77204547 CATCTGGGCTTCTGAGGGTATGG + Intergenic
1160557501 18:79735675-79735697 CCTCCCGCCTGCTGAGGTTCGGG + Intronic
1161531825 19:4794137-4794159 CATCCTGTCTGCCTGGGTTAGGG + Exonic
1161675405 19:5644915-5644937 CAGCCTGGATGCTGAGGATGTGG - Intronic
1162286729 19:9744335-9744357 CATCATGGATGCTGAGCTTTGGG + Intergenic
1162419033 19:10555328-10555350 GATCCTCGCTGCTGACGATAAGG - Exonic
1162521061 19:11179750-11179772 CTTCCTGGATGCTGAGGTCCTGG + Intronic
1163439468 19:17314415-17314437 CATTCTGGCTGCTGAGGGGCGGG + Intronic
1163649503 19:18509163-18509185 CAACCTGGCTGCTGTGGGGAAGG - Intronic
1165440377 19:35823004-35823026 CACTCTGGCTGCTGAGCTCATGG + Intergenic
1165483857 19:36083442-36083464 CACCCTAGCTGCTGAGGTCCTGG - Intronic
1167681070 19:50921679-50921701 CTTCCTGGCTCCTCTGGTTATGG + Intergenic
925776549 2:7341124-7341146 AGTCCTGGCTGCTGAGGGTGAGG - Intergenic
927394916 2:22638700-22638722 CATGCTGGCTGCTAAGGCTCTGG + Intergenic
928770768 2:34700294-34700316 CATCTTGGATGCTGAGCTTCGGG - Intergenic
929055056 2:37869503-37869525 CATTCTTGCAGCTGAGGTTTGGG - Intergenic
929738846 2:44581056-44581078 CATCCTGCTTGCTGTGGTTGTGG + Intronic
929793012 2:45037637-45037659 CATCATGGATGCTGAGCTTCAGG - Intergenic
934751864 2:96798958-96798980 CAGCGTGGCTGCTGTGGTTGGGG + Intronic
937688248 2:124722669-124722691 CAGCTGGGCTGCTGAGATTAAGG + Intronic
938560695 2:132469796-132469818 CATGCTGGCTGGTGGGGTTGAGG + Intronic
940392122 2:153144323-153144345 TATCCAGGCTCCTGAGGTGAAGG - Intergenic
943189232 2:184654467-184654489 GCTCCTTGCTGCAGAGGTTATGG + Intronic
945301937 2:208222592-208222614 CATCGTGGCTGATGAGGTCCTGG + Intergenic
946429316 2:219616214-219616236 CAGCGTGGCTCCTGAGGTCAGGG - Exonic
946498316 2:220218721-220218743 CATCCTGGCTGAAGAGATGAAGG + Intergenic
947760487 2:232600308-232600330 CATCCTGGCAGCTGCGGTCTGGG - Intergenic
948337680 2:237223486-237223508 CATCCTGGCTTCTGGGGTTGTGG + Intergenic
1169428099 20:5511736-5511758 CATCCTGGACACTGAGGTTGGGG + Intergenic
1170585833 20:17733129-17733151 CATCCTGGCTGCTGAGCCTGTGG + Intronic
1172230718 20:33333892-33333914 CATCCTGGCTGAGGAGGCCAAGG - Intergenic
1172289034 20:33762018-33762040 CCTCCTGCCTGCTGGGGTTCAGG - Exonic
1173628335 20:44490425-44490447 CATTTTGGCTGCTGAGGCTCTGG + Exonic
1175304853 20:57968991-57969013 CCTCCTGGGTGCTGACGTTTTGG + Intergenic
1176075707 20:63247424-63247446 CACCCTTGCTGGAGAGGTTAAGG - Intronic
1176454924 21:6899562-6899584 CATCCTGTCTGCCTGGGTTACGG + Intergenic
1176833097 21:13764610-13764632 CATCCTGTCTGCCTGGGTTACGG + Intergenic
1179187442 21:39095838-39095860 CATCTGGGCTGCTGAGATTAAGG + Intergenic
1179984643 21:44913718-44913740 CATCCTGGCTGCTGGGCAGAGGG - Intronic
1181011032 22:20040751-20040773 CATCCCTGCTGCAGAGGTTGGGG + Intronic
1181082223 22:20423348-20423370 CATGCGGGCTGCTGGGGTTAAGG - Intergenic
1181630013 22:24145938-24145960 CACCCTGGCTGGTGAGGAAATGG + Intronic
1182753632 22:32661023-32661045 CATCCTGGCTGATGTGGACAAGG - Intronic
1183145045 22:35982501-35982523 CATGCTGGCTGTTGAGGATGTGG - Intronic
1183847374 22:40553519-40553541 CATGGCGGCTGCTGAGGTTTTGG - Intronic
1184802398 22:46769578-46769600 CGATCTGGCTGCTGAGGTCAGGG + Intronic
1185011772 22:48318616-48318638 CATCTTGGCTGTTGTGGATAAGG + Intergenic
951803811 3:26624340-26624362 CGACCTGGCTGCAGAGGTGAAGG - Intronic
952186310 3:30973389-30973411 CATCCTGGCTGCTTTGCTGAGGG - Intergenic
952730485 3:36632938-36632960 CATAGTGGGAGCTGAGGTTATGG + Intergenic
954206055 3:49059793-49059815 AATCCGGGATGCAGAGGTTACGG - Intronic
957155056 3:76535853-76535875 CATCATGGATGCTGAGCTTCAGG - Intronic
958796602 3:98712867-98712889 CATGCTGGCGGCTGTGGATATGG - Intergenic
960087567 3:113607313-113607335 CATACTGCCTGCTGAGATGAGGG + Intronic
960934583 3:122890251-122890273 CATCCTGCCTGCAGAGGGTCTGG + Intergenic
961143451 3:124574813-124574835 CATCCTGTCTGCTCAGGGAAGGG + Intronic
961328930 3:126127661-126127683 CAGCCTCACTGCTGAGGTTGCGG + Intronic
961793564 3:129393733-129393755 CTTCCTGGCTGCTGAGTCTTGGG + Intergenic
962505126 3:136039054-136039076 CATCCAGGCTGCTGGGTTCATGG - Intronic
964430284 3:156598587-156598609 AGTCCAGGCTGCTGAGGCTATGG + Intergenic
967489180 3:190069589-190069611 CATCTTGGTTGCTAAGGATATGG - Intronic
968124314 3:196147169-196147191 CATCCTGGCAGCACAGTTTATGG + Intergenic
971957235 4:33436927-33436949 CATTCTAGCTGCTGAAGATATGG + Intergenic
975494671 4:75024616-75024638 CATCCAGTCTGCTAAGGTGAAGG - Intronic
975553258 4:75634479-75634501 GATCCTGACTGATGAGGTTTTGG + Intergenic
977947364 4:102929000-102929022 CATGCTGGCAGCTGATTTTATGG + Intronic
980969780 4:139557136-139557158 CCTCCTTGCTGCTGTGGTAATGG + Intronic
986205730 5:5623424-5623446 CATCCAGGCTGCTCAGGCTTTGG + Intergenic
986413815 5:7508410-7508432 CATCCTTCCTGCTGAGCTTGTGG - Intronic
990713487 5:58609823-58609845 AATCCTGGCTTCTGAAGTAAAGG - Intronic
992559478 5:77936202-77936224 CATCCTGGCTGCTGAGTCTGTGG - Intergenic
992967722 5:82020255-82020277 TATTCAAGCTGCTGAGGTTATGG + Intronic
994646539 5:102476800-102476822 CATCCTGGTAGCTAAGGTGAAGG - Intronic
1001098443 5:168794514-168794536 CGTCCAGGCTGCTGTGGTGAGGG + Intronic
1001579460 5:172789102-172789124 GATCCAGGCTGCCGAGCTTAGGG - Intergenic
1002694917 5:181080611-181080633 CATCCTTGCTCCTGATCTTAAGG - Intergenic
1003476868 6:6491564-6491586 CTTCCTGGCTGATGAAGCTATGG + Intergenic
1005939433 6:30549899-30549921 AATCCTGGAGGCAGAGGTTACGG - Intronic
1006629127 6:35418792-35418814 CCTCCTGGCTGGTGAGGTTTAGG - Intronic
1007988450 6:46230915-46230937 AATTCTGGGTGCTGACGTTAGGG + Intronic
1008284788 6:49635925-49635947 CTTCCTGGCTAATGAGGTAATGG + Intronic
1009418488 6:63440828-63440850 CATCCAGGTTGCTGAGGCTCAGG - Intergenic
1010669740 6:78674007-78674029 CCTCCTGGCTGCAGAGGGTGAGG + Intergenic
1012655020 6:101806453-101806475 CTGCCTGGCTGCTGTGGTTTAGG - Intronic
1012907125 6:105080225-105080247 CATCCTGGCTCTAGATGTTATGG + Exonic
1013792812 6:113855624-113855646 CATCCTGGCGGCTGGGGTCGTGG + Intergenic
1014773251 6:125480593-125480615 CATCATGGTTACTGAGGTTTAGG + Intergenic
1016452822 6:144200932-144200954 CATCGTGGCTGATGAGGTCGCGG + Intergenic
1017036769 6:150274107-150274129 CAGCACAGCTGCTGAGGTTAGGG + Intergenic
1018284840 6:162226342-162226364 CTTCCTGGGTGCTGTGGATAGGG + Intronic
1019218326 6:170457669-170457691 CAGCCTGGCTGCTGGGGCCAAGG + Intergenic
1019489878 7:1307347-1307369 CAACCTGGCTGCTCAGGCTGGGG - Intergenic
1021977903 7:26027681-26027703 AAGCCTGGCTGCTGTGGTTCAGG + Intergenic
1022330035 7:29370004-29370026 CATGCTGCCTGCTGAGGAAAGGG - Intronic
1023695850 7:42845502-42845524 AATGCTGGTTGCTGAGGATAAGG - Intergenic
1023946386 7:44806308-44806330 CCTCCTGGGTGCTGGGATTACGG - Intronic
1023980726 7:45068558-45068580 CATCCTGGCTGCAGAGAGCAAGG + Exonic
1024642471 7:51341524-51341546 GATACTGGCTCCTGTGGTTATGG - Intergenic
1028356550 7:89917210-89917232 CAGCCTTGCTGCAGAGGTTCAGG + Intergenic
1029449252 7:100631799-100631821 CCTCCCGCCTGCTGAGGTGAGGG - Exonic
1032303087 7:130708004-130708026 CACCTTGGCTGCTGGGATTATGG + Intergenic
1032672309 7:134096564-134096586 CTTCCTGACTTCTGAGGTTTTGG - Intergenic
1033966742 7:146984287-146984309 AATCCTGGAGGCTGAGGTTGTGG + Intronic
1034015796 7:147584868-147584890 GATCCTGGGAGCTGAGGATAGGG - Intronic
1034687780 7:152988766-152988788 CATGAAGGCTGCTGTGGTTACGG - Intergenic
1034960993 7:155364337-155364359 CACCCTGGCTGCGGAGCTCACGG + Intronic
1036281474 8:7404653-7404675 CTGCCTGGCTGCTGTGGTTCAGG - Intergenic
1036339995 8:7906919-7906941 CTGCCTGGCTGCTGTGGTTCAGG + Intergenic
1036485283 8:9173624-9173646 CATCCTGACTGCAGAGGAAAGGG - Intergenic
1037493521 8:19418021-19418043 GATCCTGGCTGCACAGGTGATGG - Intronic
1037606447 8:20441734-20441756 CATCCTGGATACTCAGCTTATGG + Intergenic
1037887267 8:22601641-22601663 CAGCCTGGCTGCTTAGGGTAGGG + Intronic
1039480673 8:37871204-37871226 CTTCCTACCTGCAGAGGTTACGG - Intronic
1041390087 8:57339991-57340013 CATCGTGGCTGCTGATTTTCAGG - Intergenic
1042453549 8:68975387-68975409 ACTCCTGGCTGCTGTGGTTCAGG - Intergenic
1042707361 8:71677127-71677149 ACTCCTGGCTGCTGTGGTTCAGG - Intergenic
1042790292 8:72597773-72597795 CTTCCTGGCTGATAAAGTTAGGG - Intronic
1048399514 8:134051281-134051303 CATCCTGGCTGCTCTGGGGAAGG - Intergenic
1048569590 8:135640538-135640560 CATGCTGTCTCCTGATGTTAGGG + Intronic
1049465274 8:142748424-142748446 CATCATGGATGGTGAGGTTAAGG + Intergenic
1050151964 9:2625767-2625789 AATACTGTCTGCTGAGGTTATGG + Intronic
1051872701 9:21757217-21757239 CAGCCTTGGTGCTGAGGTGAAGG - Intergenic
1053382349 9:37659330-37659352 CATCCTGGCTGCTGCTCTGAAGG + Intronic
1053413144 9:37928679-37928701 CACCCTTGCTGCTGTGGTGAGGG + Intronic
1055771286 9:79719467-79719489 CCTCCTAGCTCATGAGGTTACGG - Intronic
1057228218 9:93303636-93303658 CACCCTGGCTGCAGAGGTCAGGG - Intronic
1057982075 9:99672375-99672397 ACTCCTGGCTGCTGCGGTTCAGG - Intergenic
1058026214 9:100144188-100144210 ACTCCTGGCTGCTGTGGTTCAGG + Intronic
1059453453 9:114385395-114385417 CCTCCTGGCTCCTGCTGTTATGG + Intronic
1061222046 9:129257962-129257984 CATCCAGGCTGCTGAGTTCCCGG - Intergenic
1185664101 X:1750717-1750739 CAGCCTGCCTGCTGAAATTAAGG - Intergenic
1186569377 X:10698145-10698167 CAGCCTGCCTGATGAGGTCATGG - Intronic
1187057794 X:15757312-15757334 CATCCTGGCTACTGAAGACATGG + Intronic
1188712379 X:33416265-33416287 ATTCCTGCCTGCTGAGGGTATGG + Intergenic
1189656656 X:43251526-43251548 CATCCTGGCTGCTGTGGCCGTGG - Intergenic
1192154486 X:68733574-68733596 AGTCCTAGCTACTGAGGTTAAGG + Intergenic
1196943198 X:120797992-120798014 CATCCTGGCAGCTTAGGTTCTGG - Intergenic
1198368837 X:135971774-135971796 CTTGCTGCCTCCTGAGGTTAAGG - Intronic
1201260448 Y:12153930-12153952 CATTTTGGCTGCTGAAGTTTTGG - Intergenic
1201412761 Y:13717143-13717165 CTGCATGGCTGCTGAAGTTATGG + Intergenic
1202115729 Y:21467751-21467773 CACTCTGGCTGCTGGGGTGAGGG - Intergenic
1202378583 Y:24258531-24258553 CGGCCAGGCTGCTGAGGTGATGG + Intergenic
1202492199 Y:25411590-25411612 CGGCCAGGCTGCTGAGGTGATGG - Intergenic