ID: 1072664638

View in Genome Browser
Species Human (GRCh38)
Location 10:97384523-97384545
Sequence GGCCTTCATCCTGGCTGCTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 368
Summary {0: 2, 1: 1, 2: 5, 3: 38, 4: 322}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1072664638_1072664641 5 Left 1072664638 10:97384523-97384545 CCTCAGCAGCCAGGATGAAGGCC 0: 2
1: 1
2: 5
3: 38
4: 322
Right 1072664641 10:97384551-97384573 TACCCCCAACCTCAGCTGCCTGG No data
1072664638_1072664648 20 Left 1072664638 10:97384523-97384545 CCTCAGCAGCCAGGATGAAGGCC 0: 2
1: 1
2: 5
3: 38
4: 322
Right 1072664648 10:97384566-97384588 CTGCCTGGACGGAGACCCTGAGG No data
1072664638_1072664645 9 Left 1072664638 10:97384523-97384545 CCTCAGCAGCCAGGATGAAGGCC 0: 2
1: 1
2: 5
3: 38
4: 322
Right 1072664645 10:97384555-97384577 CCCAACCTCAGCTGCCTGGACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1072664638 Original CRISPR GGCCTTCATCCTGGCTGCTG AGG (reversed) Intronic
900146151 1:1159625-1159647 GCCCTCCACCCTCGCTGCTGTGG - Intergenic
900338756 1:2177802-2177824 CTGCTTCTTCCTGGCTGCTGCGG + Intronic
900490234 1:2944444-2944466 GGGCTGCCTCCTGGCTGCCGAGG + Intergenic
900695944 1:4010522-4010544 GGGCCTCTCCCTGGCTGCTGTGG + Intergenic
902052750 1:13577145-13577167 TCCCTTCATCCTGCCAGCTGAGG - Intergenic
902482386 1:16718718-16718740 GGCCTTCTTGGTGGCTGCTTTGG - Intergenic
902797568 1:18809280-18809302 GTCCTCAATCCTGGATGCTGGGG - Intergenic
902849134 1:19139855-19139877 AGCCCTGATCCTGGATGCTGTGG - Intronic
902979644 1:20113737-20113759 GCCCTTTATAGTGGCTGCTGCGG + Exonic
903254163 1:22081484-22081506 GCTCTTTATCCAGGCTGCTGGGG + Intronic
903301854 1:22384958-22384980 CGAATTCATACTGGCTGCTGAGG + Intergenic
903374187 1:22855402-22855424 GGCTTACCTGCTGGCTGCTGTGG - Intronic
903414129 1:23169700-23169722 AGCCTTCCTCCTGGCTTCTCAGG - Intronic
903856699 1:26342134-26342156 GGCCTGCATGCTGGCTCCTGGGG + Intronic
904327587 1:29737483-29737505 GCTCTTCTTTCTGGCTGCTGGGG - Intergenic
906717357 1:47980037-47980059 GGGCTTCATCCTGGGTGCACTGG - Intronic
907297916 1:53467236-53467258 AGCAAGCATCCTGGCTGCTGGGG + Exonic
907414817 1:54307030-54307052 GGCCTTCCTCCTGGAGGCTGTGG - Intronic
907804696 1:57806499-57806521 GGCCTTCCCCCTAGCTTCTGGGG - Intronic
912595942 1:110875740-110875762 GGACTCCAGCATGGCTGCTGGGG + Intronic
912949689 1:114112026-114112048 GGGCTTCCTGCTGGGTGCTGGGG + Intronic
912996356 1:114535984-114536006 GGGCTTCAACATGGCTGCTGAGG - Intergenic
913228925 1:116724925-116724947 TTCCTTCATCCTGCCTGCAGGGG + Intergenic
913330453 1:117662970-117662992 TTCCTGCATCCTGGCTGCTCTGG + Intergenic
914947818 1:152081311-152081333 CGCCTTCTCCATGGCTGCTGTGG + Intergenic
918858219 1:189786912-189786934 AGCCTTCATCGTCACTGCTGTGG + Intergenic
919792463 1:201300885-201300907 GCCCTCCATCCTGTCTGCTAAGG - Intronic
919822868 1:201483909-201483931 GGCCTTAACCCTGGCTCCTGAGG - Exonic
920387450 1:205579022-205579044 GGCCCTCCCCCTGCCTGCTGTGG + Intronic
921176979 1:212604306-212604328 GGACTTCATCTTGGATTCTGGGG + Intronic
922229140 1:223670599-223670621 GGCCTTCATCCTGGCAGGAAAGG + Intergenic
922749736 1:228064816-228064838 GGCCTTGCACCTGCCTGCTGCGG - Intergenic
923127086 1:231041281-231041303 GGCGTTCTTGCTGACTGCTGCGG - Intergenic
924531062 1:244894316-244894338 TACCTTCATCCTGGCTGGCGTGG - Intergenic
924846235 1:247775236-247775258 GGCTTTCCTCCTGGCTGCCATGG + Intergenic
1064970297 10:21059132-21059154 GGGCTTCACCCCGACTGCTGGGG - Intronic
1065508525 10:26454391-26454413 GGACTTTATTCTGGCTGCTCAGG + Intronic
1065971786 10:30811426-30811448 GGCCTGTTGCCTGGCTGCTGAGG - Intergenic
1067553517 10:47252262-47252284 AGCCTTCATCCTGCTGGCTGAGG + Intergenic
1067557548 10:47283295-47283317 TGCCTCCTTCCTGGCTGTTGGGG - Intergenic
1069710005 10:70482099-70482121 GGCCATGCACCTGGCTGCTGAGG - Intronic
1069827025 10:71260681-71260703 GCCTTTGATCCTGGCTGCCGAGG - Intronic
1069934306 10:71904870-71904892 GGCCTCCTCCCTGCCTGCTGGGG - Intergenic
1070201070 10:74207071-74207093 GCCACTCATGCTGGCTGCTGTGG + Intronic
1070706918 10:78646486-78646508 GGCCTCTCTCCTGGCTTCTGAGG + Intergenic
1070765225 10:79052595-79052617 GCTCTCCAACCTGGCTGCTGGGG + Intergenic
1070813176 10:79308470-79308492 GGCCCTCTCCCTGGCTGGTGTGG - Intronic
1071203946 10:83252762-83252784 TCCCTGCATCCTGGCTGCTCTGG - Intergenic
1071482966 10:86078832-86078854 GGCATCCATGCTGGGTGCTGGGG - Intronic
1071838012 10:89439052-89439074 CACCTTCATCCTGGCTCCTGTGG - Exonic
1072664524 10:97384113-97384135 GGCCTCCGTCCTGGCTGCTGAGG - Intronic
1072664534 10:97384150-97384172 GGCCTCTGGCCTGGCTGCTGAGG - Intronic
1072664546 10:97384187-97384209 GAGCCCCATCCTGGCTGCTGAGG - Intronic
1072664571 10:97384297-97384319 GGCCTCCGTCCTGGCTGCTGAGG - Intronic
1072664584 10:97384334-97384356 GGCCTCCCTCCAGGCTGCAGAGG - Intronic
1072664638 10:97384523-97384545 GGCCTTCATCCTGGCTGCTGAGG - Intronic
1072664659 10:97384597-97384619 GGTCTCCGTCCTGGCTGCCGAGG - Intronic
1072664675 10:97384672-97384694 GGCCTTCATCCTGGCTGCTGAGG - Intronic
1072664683 10:97384709-97384731 GGTCTCCGTCCAGGCTGCTGAGG - Intronic
1072664695 10:97384746-97384768 GGTCTCCATCCTGGCTGCCGAGG - Intronic
1072664710 10:97384821-97384843 GGTCTCCGTCCTAGCTGCTGAGG - Intronic
1072664744 10:97384932-97384954 GGTCTTCATCCTGGCTGCCAAGG - Intronic
1072664756 10:97384969-97384991 GGCCTCTGTCCAGGCTGCTGAGG - Intronic
1072664782 10:97385045-97385067 GGCCTTCATCCTGGCTGCCAAGG - Intronic
1073101823 10:101010521-101010543 TGCCTTGACCCCGGCTGCTGCGG + Intronic
1073814773 10:107194639-107194661 GCTCTTCATCCTGGCTGTGGTGG + Intergenic
1074500720 10:114021495-114021517 ACCCTACATCCTGTCTGCTGAGG - Intergenic
1075239556 10:120765465-120765487 GTCCTGCATCCTGGCTGATGAGG - Intergenic
1075411890 10:122234232-122234254 GTCCTTCCTGCTGGCAGCTGGGG - Intronic
1075595561 10:123726690-123726712 GGCCACCATCCTGTCTGGTGAGG + Intronic
1075649716 10:124119490-124119512 GCTCTTCACCCTGGCTGCTGGGG + Intergenic
1075732107 10:124642557-124642579 GGCAACCATTCTGGCTGCTGTGG - Intronic
1077021241 11:418008-418030 TGCCCCCATCCTGGCTGTTGGGG - Intronic
1077091073 11:778518-778540 GACCTTCATACTGGCAGCAGGGG - Intronic
1077252760 11:1567847-1567869 GGCCTGCTGCCTGCCTGCTGTGG + Intronic
1077385444 11:2267490-2267512 GGCTTTGACCTTGGCTGCTGAGG + Intergenic
1079380684 11:19934571-19934593 GGCCTTCATGCTTTCTGCTCAGG - Intronic
1080439633 11:32279992-32280014 GGCATTCATCCTGGCTCCAATGG - Intergenic
1080581249 11:33645847-33645869 GGCCTTCAGCCTGGCATCCGCGG + Exonic
1081083864 11:38775181-38775203 GTCCTGCATCCTAGCTGCTCCGG - Intergenic
1081702264 11:45159277-45159299 GGCCTCCTTCCTGGCTGCCCTGG + Intronic
1081731647 11:45376009-45376031 GGGCTTTATCCTGCCAGCTGTGG + Intergenic
1081756149 11:45546059-45546081 GCCACTCATCCTGGCTGTTGTGG + Intergenic
1081929715 11:46860465-46860487 AGCCTCACTCCTGGCTGCTGGGG + Intronic
1083236440 11:61353888-61353910 GGCCTTCGTCCTCACTGTTGTGG - Exonic
1083261391 11:61524935-61524957 GGCCTGCGTACTGGCAGCTGTGG - Intronic
1084435747 11:69138286-69138308 GGGCTTGACCCTGGCTTCTGAGG + Intergenic
1084704312 11:70806930-70806952 GCCCTTCACCCGGCCTGCTGTGG - Intronic
1084713212 11:70857102-70857124 AGACTGCCTCCTGGCTGCTGGGG - Intronic
1088869939 11:113882110-113882132 GGCCATTTTCCTAGCTGCTGAGG - Intergenic
1090925507 11:131246648-131246670 GGCCTTCTCCTGGGCTGCTGAGG - Intergenic
1091222303 11:133936671-133936693 AGCTTCCATCCAGGCTGCTGAGG + Intronic
1091266787 11:134277127-134277149 GGCCTTCATCCTGGCTGCAGAGG + Intronic
1098253172 12:68589965-68589987 TTCCTGCATCCTGGCTGCTCCGG + Intergenic
1098453898 12:70650746-70650768 GGCCTGCATCCTGTGTTCTGTGG - Intronic
1099984642 12:89648851-89648873 TCCCTGCATCCTGGCTGCTCTGG + Intronic
1101954763 12:109203548-109203570 GGCTTTCTTGCTCGCTGCTGGGG + Intronic
1103342999 12:120230988-120231010 GCCATTCATTCTAGCTGCTGGGG - Intronic
1104044998 12:125155651-125155673 GTTCTTGACCCTGGCTGCTGGGG + Intergenic
1104856910 12:131906602-131906624 GGCCTTCACCCTTCCTGCTAGGG + Intronic
1104945815 12:132414480-132414502 GGCCTCCGTCCAGGCTGCGGTGG + Intergenic
1105067057 12:133210108-133210130 GGCCTGCACCCTGAGTGCTGAGG - Intergenic
1105337386 13:19486648-19486670 GGCCTGCAGCCAGTCTGCTGGGG + Intronic
1105705520 13:22965579-22965601 TCCCTTCATCCTGGCTGGGGCGG + Intergenic
1105917051 13:24926504-24926526 GGCCTTAATCAGGGCTGCTTTGG + Intergenic
1106809501 13:33346249-33346271 GGCCTTCAAGCTGTCAGCTGGGG - Intronic
1107401571 13:40074443-40074465 GGCCTTCATGTTAGCTCCTGGGG - Intergenic
1108592672 13:51924728-51924750 GGGGTGCATCCTGGCTGCTGGGG - Intergenic
1113484503 13:110644590-110644612 GGCCTTTCTCCTGGCTTCTATGG + Intronic
1113803032 13:113096292-113096314 GGCACTCCGCCTGGCTGCTGTGG + Intronic
1118639959 14:67783029-67783051 GGCCTTCCTCCTGGCTGCCTGGG - Exonic
1118731179 14:68668067-68668089 GGCCTCACCCCTGGCTGCTGAGG + Intronic
1118805943 14:69237013-69237035 GGCTTTCTCCCTGGCTTCTGTGG + Intronic
1119037782 14:71245373-71245395 GGCTTTCCTCATGGCTTCTGTGG + Intergenic
1119693992 14:76698262-76698284 GGCCTTCACACTGCCAGCTGGGG - Intergenic
1120182046 14:81353808-81353830 GGTCTACATCCTGTTTGCTGTGG - Intronic
1120848497 14:89147464-89147486 GACGGTCATCCTGGCTGCAGTGG + Intronic
1121049941 14:90813846-90813868 GGACTTCTTCCTGGCTTTTGGGG - Intronic
1121465983 14:94115853-94115875 GGACATCATCTTGGCTGCTATGG - Exonic
1121468053 14:94128581-94128603 GGACATCATCTTGGCTGCTATGG + Exonic
1122077454 14:99245634-99245656 GGCATTCGTCCCGGGTGCTGGGG - Intronic
1122337628 14:101004396-101004418 GGCCTCCATCCTGGGGCCTGTGG - Intergenic
1122345350 14:101055206-101055228 GAACTGCATCCTTGCTGCTGGGG + Intergenic
1122830047 14:104391455-104391477 AGCCTTCAGGCTGGGTGCTGCGG - Intergenic
1123930868 15:25171118-25171140 GGCCATGAGCCAGGCTGCTGGGG + Intergenic
1126362403 15:47860001-47860023 GGGCTTCATCCAGTCAGCTGAGG + Intergenic
1126582880 15:50257433-50257455 CGCCTCCGCCCTGGCTGCTGGGG + Exonic
1128300816 15:66565415-66565437 GGCCATCAGCCTGGCTGCAGGGG - Exonic
1128813459 15:70588135-70588157 GGCCTTCATTCTGAAGGCTGAGG - Intergenic
1128985670 15:72219086-72219108 GGGCTTCGACATGGCTGCTGAGG + Exonic
1128988355 15:72237580-72237602 GCCTTTCATTCTGGCTGGTGGGG - Intergenic
1131054318 15:89366709-89366731 CCCCTTCTTCCTTGCTGCTGTGG - Intergenic
1132227105 15:100151108-100151130 GTCCTTCAACCCTGCTGCTGGGG + Intronic
1132758797 16:1499053-1499075 GGCCTTCATCCTCCCTTCTCTGG - Intronic
1132801688 16:1757824-1757846 GGCCTGCATCATGGGGGCTGCGG + Intronic
1133233402 16:4376824-4376846 GCCCTTCACCCTGGGGGCTGGGG - Intronic
1135907659 16:26528062-26528084 GGCAATCATCCTGGCTTCTTAGG - Intergenic
1136276339 16:29181333-29181355 GGCCATCATTCTGGCAGCAGTGG + Intergenic
1139026463 16:62824213-62824235 AGCCTTCATCCTTGCTGCTAAGG + Intergenic
1140092624 16:71850607-71850629 GGCCTTCACCCTTGCTGTTGGGG - Exonic
1140400143 16:74665088-74665110 GGCTTTCGTCCTGCCTGTTGTGG - Intronic
1141785013 16:86193611-86193633 GGGCTGAGTCCTGGCTGCTGGGG + Intergenic
1142088346 16:88196630-88196652 GGCCTACAGGTTGGCTGCTGTGG + Intergenic
1143025203 17:3937495-3937517 TGCCTCCATCGTGGCTGCGGTGG - Exonic
1145188224 17:20814688-20814710 AGCCTTCCTGCTGGCTCCTGGGG - Intergenic
1146709217 17:35026470-35026492 GGCCTGCATCCTGGCTCCCTGGG + Exonic
1147167162 17:38599729-38599751 TGCCCTCATCCTGTCTGCTGGGG - Intronic
1148329781 17:46806871-46806893 GGCCCTCACGATGGCTGCTGGGG + Intronic
1148332563 17:46821051-46821073 AGCCAGCATCCTGGGTGCTGTGG + Intronic
1148687865 17:49510608-49510630 TTGCTCCATCCTGGCTGCTGTGG + Exonic
1149057894 17:52387511-52387533 TCCCTGCATCCTGGCTGCTCTGG + Intergenic
1149362829 17:55911858-55911880 TGCCATCATGCTGGCTGCAGTGG - Intergenic
1151353416 17:73544842-73544864 GCTGTTCATCCAGGCTGCTGGGG + Intronic
1151375557 17:73686398-73686420 TCCCTGCATCCTGGCTGCTCTGG + Intergenic
1152023101 17:77791892-77791914 GGACTTCATCCTGGGTGAAGGGG + Intergenic
1152483185 17:80570065-80570087 CGCTCTCATTCTGGCTGCTGTGG + Intronic
1152679690 17:81660285-81660307 TGCCTTAATCCTAGCTACTGGGG + Intronic
1203159820 17_GL000205v2_random:38877-38899 GCCCTTCCTCCTGGCGTCTGAGG - Intergenic
1155246945 18:23919790-23919812 GGGCTTCATCCTGACAGCCGAGG + Intronic
1156294030 18:35773890-35773912 GCACTTCAGCCAGGCTGCTGGGG - Intergenic
1156374336 18:36500137-36500159 GGATTTCATTCTGGCTGCGGTGG + Intronic
1156488161 18:37479681-37479703 GGCCTTTATCCTCCCTACTGTGG + Intronic
1156641986 18:39112711-39112733 GGCCATCATGCAGGCTTCTGTGG + Intergenic
1157287468 18:46386834-46386856 GGCCTAAATCCTGTCTGCTGTGG - Intronic
1157359284 18:46963569-46963591 GGCCTGCATCCAGGCCTCTGAGG + Exonic
1157360278 18:46969496-46969518 GGCCTGCATCCAGGCCTCTGAGG + Exonic
1157360877 18:47023088-47023110 GGCCTGCATCCAGGCCTCTGAGG + Exonic
1157361867 18:47029003-47029025 GGCCTGCATCCAGGCCTCTGAGG + Exonic
1157593286 18:48848768-48848790 GCCTTTCTCCCTGGCTGCTGTGG + Intronic
1157611319 18:48957990-48958012 TGCCTCCATTCTTGCTGCTGGGG - Intergenic
1158393043 18:57059092-57059114 GGGCTTAAACCCGGCTGCTGTGG - Intergenic
1159471855 18:68867462-68867484 GGCCTGCATCCTGGGGGCTGGGG + Intronic
1159945124 18:74438965-74438987 GGCCTTATTCCCTGCTGCTGGGG - Intronic
1160969712 19:1762183-1762205 GACCCTCGTGCTGGCTGCTGGGG + Intronic
1161699819 19:5788432-5788454 GGCCTCCACCCCAGCTGCTGAGG + Intronic
1162362084 19:10226678-10226700 GGATTTCATCCTGGCTGGGGAGG - Intronic
1162398431 19:10431042-10431064 GGCCCAAATCCTGGCAGCTGCGG - Intronic
1163649508 19:18509169-18509191 GACCTCCAACCTGGCTGCTGTGG - Intronic
1163842585 19:19620309-19620331 GGCCTTCAGGCTGGGTGCAGTGG + Intergenic
1164063389 19:21694194-21694216 GGTCCTCATCCTCCCTGCTGTGG - Intergenic
1164742082 19:30583318-30583340 GGCCTTTCTCCAGGCTGGTGGGG + Intronic
1164783307 19:30910627-30910649 GGCCCTGCTCCAGGCTGCTGGGG - Intergenic
1165340164 19:35205621-35205643 GCCCTTCCTCCTGGCTCCTGCGG + Intergenic
1166102651 19:40580365-40580387 GGCCGTCCTCCTAGCTGCTGAGG - Exonic
1167105457 19:47427717-47427739 GACGTTCCTCCTGGCTACTGGGG - Intergenic
1167463228 19:49637165-49637187 GGGCTTCGTCCTGTCTGCCGGGG - Intronic
1167485152 19:49758427-49758449 GACCTTGATCCTGGCTGCCTGGG + Intronic
1167510153 19:49891508-49891530 GGCCTCCACCCTGGCTGCCCGGG - Intronic
925608597 2:5684121-5684143 GTCCTGCCTTCTGGCTGCTGGGG - Intergenic
925744778 2:7034524-7034546 GTCCTTCCTCCGGGCTGCTACGG + Intronic
925771277 2:7285178-7285200 GGCCTGCTTCTTGCCTGCTGGGG + Intergenic
925780264 2:7375414-7375436 TTCCTTCATCCTGGCTTCTCTGG + Intergenic
925967271 2:9077637-9077659 TTCCTTCATCCTGGCTGTTTAGG + Intergenic
926304547 2:11628461-11628483 GGCCTTGAGCTTGGCTGCCGGGG + Intronic
927070625 2:19525081-19525103 TGCCATTATCCTGGCTGTTGAGG - Intergenic
927137159 2:20105440-20105462 GGCCTCCCTCCAGGCGGCTGGGG - Intergenic
929544139 2:42844690-42844712 GGCTTTTGTCCTGGGTGCTGAGG + Intergenic
929601956 2:43210178-43210200 GCCCTTCAGCCTGGCACCTGAGG - Intergenic
932063584 2:68529966-68529988 CGCCTTCTCCATGGCTGCTGTGG + Intronic
932721625 2:74142919-74142941 GGATTTCATCCTGGCTTTTGGGG + Intronic
933288543 2:80410812-80410834 GTCCCTGGTCCTGGCTGCTGAGG + Intronic
933914632 2:86977014-86977036 GGCGTTCATAATGGCTGATGAGG - Intronic
934008361 2:87792885-87792907 GGCGTTCATAATGGCTGATGAGG + Intronic
935236097 2:101139431-101139453 TGCCTGCATCCAAGCTGCTGTGG + Intronic
936012793 2:108935925-108935947 GGCCTTCACCCTTGGTGGTGTGG + Intronic
936455864 2:112673880-112673902 GGCCTGGGCCCTGGCTGCTGAGG + Intergenic
937247983 2:120505845-120505867 GTACTGCATCCTGGCTGCCGTGG - Intergenic
939659016 2:144864516-144864538 GGCTTGTATCCTGTCTGCTGTGG + Intergenic
941595426 2:167471050-167471072 CTCCTTCATCCTGTCTGATGGGG + Intergenic
944583083 2:201149952-201149974 GTGCTTCATCCTGGGTGCGGTGG + Intronic
945124175 2:206489748-206489770 CTCCTTCACCGTGGCTGCTGTGG + Intronic
946419703 2:219557904-219557926 GGCCTGCAGCCTGGATGCAGAGG + Exonic
946619863 2:221549247-221549269 GGTCTTCATCCTGCCTGCTGTGG + Intronic
948258408 2:236584846-236584868 GGCTGCCATCCGGGCTGCTGGGG - Intergenic
1170436597 20:16337092-16337114 GGCCTGCAGACAGGCTGCTGTGG - Intronic
1170688200 20:18588059-18588081 GGCCTTCATGGCGGCGGCTGGGG - Exonic
1170917127 20:20638166-20638188 GGCTGTCCTCCTGGCTCCTGAGG - Intronic
1170980841 20:21211353-21211375 GTCCTTTCTCCTGGCTCCTGGGG + Intronic
1172592999 20:36130715-36130737 GCCATTCACCCTGGATGCTGGGG - Intronic
1172989783 20:39026078-39026100 GGCTTTCAGGCTGACTGCTGAGG - Intronic
1173189943 20:40868557-40868579 GGACTTCACCCTGGAGGCTGTGG + Intergenic
1173606326 20:44334425-44334447 GACCTTCCTGCTGGATGCTGGGG - Intergenic
1173944556 20:46940599-46940621 GGCCTTGGTCCTGGCTGCATGGG - Intronic
1174113811 20:48213733-48213755 GGCCCTCAGCAAGGCTGCTGGGG + Intergenic
1174988882 20:55487398-55487420 GGCTTTAAGCCTGGCTGCAGTGG + Intergenic
1175829254 20:61953105-61953127 ACCCTCCATCCTGGCAGCTGAGG - Intergenic
1175901959 20:62363502-62363524 GGCCTGCATCCTGGCAGGGGAGG + Intronic
1175910531 20:62403226-62403248 GGACTTCACCCTGTCTTCTGGGG - Intronic
1176521801 21:7829922-7829944 GGCCTTTCTCCTGGCTGCAGTGG - Intronic
1176673902 21:9759113-9759135 GCCCTTCACCCTGGCAGCAGCGG - Intergenic
1178655821 21:34459934-34459956 GGCCTTTCTCCTGGCTGCAGTGG - Intergenic
1179494735 21:41764408-41764430 GGGCCTCTTCCAGGCTGCTGGGG - Intronic
1179545428 21:42110013-42110035 GGGCTGCATCCTGACTTCTGTGG - Intronic
1181178656 22:21052381-21052403 GCCCTACAGCCTGTCTGCTGGGG + Intronic
1181851666 22:25754119-25754141 GGCCTTCATAGGGGCTGCTCTGG + Intronic
1182358923 22:29735333-29735355 TGCCTTCCTCCTGCCTCCTGAGG - Intronic
1182554673 22:31122827-31122849 ATCCTTCAAACTGGCTGCTGAGG - Intronic
1182994247 22:34798429-34798451 GGCCTACAGCATGGCTACTGAGG - Intergenic
1183236746 22:36624444-36624466 GACCCTCAGCCTGGGTGCTGTGG - Intronic
1183490816 22:38114740-38114762 GAGCTGCATCCTTGCTGCTGTGG - Intronic
1183686199 22:39362649-39362671 GGCATCCATCCTGCCTCCTGGGG - Intronic
1184497381 22:44849864-44849886 GGCCTTTGTCCTGGCCCCTGGGG + Intronic
1184946198 22:47805740-47805762 GGCCTTCCTCTTTGCTGTTGTGG + Intergenic
1184986610 22:48140319-48140341 GGACAAAATCCTGGCTGCTGTGG + Intergenic
1185061712 22:48610472-48610494 GACCTTCATGCTGGCTCCCGGGG + Intronic
1185105632 22:48868052-48868074 GTCCTTCGTCCTGCCTGGTGGGG + Intergenic
950097214 3:10337281-10337303 GGCCACCATCCTGCCAGCTGTGG - Intronic
950195634 3:11007282-11007304 GGGCCTCATGCTGGGTGCTGAGG - Intronic
953623468 3:44552042-44552064 GTCCTTGATCCAGGTTGCTGTGG - Intergenic
954415707 3:50392320-50392342 GCCTTTCAGCCTGGCAGCTGTGG + Intronic
955938947 3:64129758-64129780 GGGCTGTGTCCTGGCTGCTGGGG + Intronic
956408283 3:68951252-68951274 GGCCTACATCATGGCTGTTGTGG + Intergenic
959979784 3:112503248-112503270 AGCCTTCAGGCTGGGTGCTGTGG + Intergenic
960052027 3:113248171-113248193 GGCTTTCTGCCTGGCTGCAGAGG - Intronic
961204750 3:125073166-125073188 AGCCCTCCTGCTGGCTGCTGGGG + Intergenic
961212872 3:125139551-125139573 GGTCCCCATCCTGCCTGCTGGGG + Intronic
961334132 3:126160058-126160080 CCCCTGCATCCTGTCTGCTGAGG + Intronic
961481787 3:127185054-127185076 GGTCTTCAGCCTGGCCGCTGGGG - Intergenic
961684799 3:128622380-128622402 TACCTTCATCCTGGCTTCTGCGG + Exonic
962117845 3:132530900-132530922 GGCCTTCTTCCTTGTTGCTTTGG + Intronic
962402765 3:135075458-135075480 GGCCTTCTACCTGGGTGCTTGGG - Intronic
964540885 3:157778410-157778432 GGCCTTGATCCAGGCTCCTCCGG - Intergenic
966824609 3:183953190-183953212 TGTCTACATCCAGGCTGCTGGGG - Exonic
967883406 3:194317134-194317156 GGGCTCCATCCCGGCTGCTTGGG + Intergenic
968129562 3:196184926-196184948 GGCCTTGATCCTGGCTTCCCAGG - Intergenic
968530483 4:1088747-1088769 GCCCTGCATCCTGGCTGCTCTGG + Intronic
968573435 4:1354168-1354190 GGCCTGCAGCCTCACTGCTGAGG - Intronic
968945742 4:3662715-3662737 GGCCTTCTTCCAGGCTGCAGGGG + Intergenic
969333825 4:6495132-6495154 GGACTTCATGCTGGCTGTGGAGG - Intronic
969484637 4:7465377-7465399 GGGCTTTATCCAAGCTGCTGTGG + Intronic
970538718 4:17056108-17056130 GGGGTTGATGCTGGCTGCTGAGG - Intergenic
971118965 4:23682182-23682204 GGCCTTCAATCTAGCAGCTGGGG + Intergenic
972335565 4:38104670-38104692 GGACTTCATACTGCCTGATGCGG - Intronic
972593612 4:40510958-40510980 GGCATTAATTTTGGCTGCTGTGG + Intronic
977583202 4:98747115-98747137 GACATTTATCCTGGCAGCTGTGG + Intergenic
984590062 4:181607143-181607165 GGCCCTTATCCTGCCTGCTTTGG + Intergenic
985522964 5:387567-387589 GCCTTTCACCCTGTCTGCTGAGG + Intronic
985760136 5:1744715-1744737 GGCATTAATTCTGGGTGCTGGGG + Intergenic
985930673 5:3054888-3054910 GGGCTTCAGGCTGGCTGCAGTGG - Intergenic
986232920 5:5883617-5883639 GGCCTTTCTGCTGGCTGCTCAGG + Intergenic
986468562 5:8051147-8051169 GGCTTTCATCCAGGGTGCTTTGG - Intergenic
990876617 5:60493775-60493797 GGTCTTCATGGTGGGTGCTGGGG - Intronic
990877141 5:60498530-60498552 GGCCAGCATCCTAGCTGCTAAGG + Intronic
998532589 5:142899640-142899662 GGGCTTCATCCTGCCCCCTGAGG + Intronic
998594509 5:143514691-143514713 GACCTCCATCCAGGATGCTGGGG - Intergenic
1001681066 5:173557272-173557294 GGCCTTCAGGCTGGCTGCATGGG + Intergenic
1002372387 5:178765664-178765686 GTTCTTGACCCTGGCTGCTGGGG - Intergenic
1003422620 6:5972401-5972423 GGGCTTCAACATGGCTTCTGAGG - Intergenic
1004520864 6:16359379-16359401 GGCCATCCTCCTGCCTGCTGTGG - Intronic
1004752957 6:18582740-18582762 GGCCTCACTCCTGGGTGCTGGGG + Intergenic
1006114695 6:31769317-31769339 TGCCTGCCTTCTGGCTGCTGGGG + Intronic
1006165392 6:32061674-32061696 GGCCTCCATGCTGGGTTCTGTGG + Intronic
1006166348 6:32067938-32067960 GGCCTCCATGCTGGGTTCTGTGG + Intronic
1006645787 6:35513065-35513087 GGCCATCCTGCAGGCTGCTGGGG - Intergenic
1008027482 6:46653936-46653958 GACCTTCTTACAGGCTGCTGGGG + Intronic
1009418489 6:63440834-63440856 GGTCTTCATCCAGGTTGCTGAGG - Intergenic
1011366343 6:86586370-86586392 CGCCCTCAGCATGGCTGCTGTGG - Intergenic
1012902332 6:105020604-105020626 GGCTTTCAGCCTGGGTGCAGTGG - Intronic
1013792810 6:113855618-113855640 TGCGTCCATCCTGGCGGCTGGGG + Intergenic
1015203996 6:130614402-130614424 GCCCCTCAGCCTCGCTGCTGTGG - Intergenic
1015478701 6:133682676-133682698 GACCATCATCCTGGGTGTTGTGG + Intergenic
1017029499 6:150208208-150208230 GGCCTACATCCTCCCTGCTATGG - Intronic
1019179599 6:170177980-170178002 GGCCCACTTCCTGGGTGCTGGGG - Intergenic
1019489881 7:1307353-1307375 GGTCATCAACCTGGCTGCTCAGG - Intergenic
1019552281 7:1608993-1609015 GGATTTCCTCCTTGCTGCTGGGG + Intergenic
1020082123 7:5291775-5291797 CGCCATCAACCTGGCCGCTGTGG + Exonic
1021722352 7:23516627-23516649 GTCCTTCCTCCTTGCTTCTGAGG + Intronic
1023992970 7:45140794-45140816 GGCCCTAAGCCTGGATGCTGTGG - Intergenic
1024608595 7:51043645-51043667 GGGCTCCATCCGGGCTGCAGTGG + Exonic
1024720711 7:52135111-52135133 GTCCTCCCACCTGGCTGCTGTGG - Intergenic
1025196795 7:56940365-56940387 CGCCATCAACCTGGCTGCTGTGG - Intergenic
1025252110 7:57358611-57358633 TGCCTGCCTCCTGGCTGTTGAGG - Intergenic
1025675153 7:63636572-63636594 CGCCATCAACCTGGCTGCTGTGG + Intergenic
1026298501 7:69077248-69077270 GCCCTTCAGCCTGGGTGCGGTGG + Intergenic
1026837312 7:73647583-73647605 CTCCTTCCTCCTGGCAGCTGAGG + Intergenic
1029274212 7:99394506-99394528 TGCCTTCATCCTAGCTGCTGGGG + Exonic
1033584449 7:142763629-142763651 GGGCTGCATCCTGTCTGCTTAGG + Intronic
1033585916 7:142774192-142774214 GGGCTGCATCCTGTCTGCTTAGG + Intergenic
1034437309 7:151069285-151069307 GGTCTCCAGCCTGGCTGCTCAGG + Intronic
1034546053 7:151790125-151790147 GGGCTTCATGCTGGGGGCTGGGG - Intronic
1034782810 7:153896686-153896708 GGCTGTCATCCTAGCTACTGAGG + Intronic
1035387014 7:158479864-158479886 GGGCGTCATCCTCGCTGCTGTGG + Intronic
1036788399 8:11702714-11702736 GGCCTGCATCCCGGAAGCTGGGG - Intronic
1039423617 8:37466815-37466837 GACCTTCCTCCTTCCTGCTGGGG - Intergenic
1040959856 8:53019709-53019731 GGCATTCATCTTTGCTGCTCTGG + Intergenic
1041831634 8:62161711-62161733 GGCATTCATGATGGCTGTTGAGG - Intergenic
1045108126 8:98913543-98913565 GGCCTTCATCCAGACTCCTTGGG + Intronic
1045325460 8:101114506-101114528 TGCCTTAGTTCTGGCTGCTGTGG - Intergenic
1045437031 8:102173786-102173808 TTCCTGCATCCTGGCTGCTCTGG - Intergenic
1047135921 8:122078527-122078549 AGCCTTCATCCAGGGTGCTTTGG - Intergenic
1047543792 8:125796576-125796598 GTCCAGCATGCTGGCTGCTGTGG + Intergenic
1049310850 8:141933084-141933106 GGCCCTCATCCAACCTGCTGGGG - Intergenic
1049459970 8:142722112-142722134 GGCAAGCATCCTGGCTTCTGGGG - Intergenic
1049579863 8:143406402-143406424 GCCCTCCCTCCTGGCTGCTGTGG - Intergenic
1052621983 9:30924230-30924252 GGCTTTCAACCTGTTTGCTGGGG - Intergenic
1052947348 9:34179051-34179073 GGACTTCAACATGGCGGCTGCGG + Exonic
1055985993 9:82056829-82056851 GGCCTTCATGGAGGCTGCTGAGG - Intergenic
1056585343 9:87924303-87924325 GGCCTTCATGGAGGCTGCTGAGG + Intergenic
1056611538 9:88128637-88128659 GGCCTTCATGGAGGCTGCTGAGG - Intergenic
1058724056 9:107785256-107785278 GTCCTTCAACCTGGCAGATGTGG - Intergenic
1058750595 9:108035127-108035149 GTCCTCCATCCTCTCTGCTGGGG - Intergenic
1059215480 9:112557490-112557512 AGACATCTTCCTGGCTGCTGAGG - Intronic
1059400855 9:114070224-114070246 GGCCATCACACTGGCTGCAGTGG + Intronic
1059485572 9:114624151-114624173 GGCCTTAATTCTGCCTCCTGGGG + Intronic
1059824849 9:118017324-118017346 GGCCTAGATGCTGGGTGCTGAGG + Intergenic
1060521403 9:124296108-124296130 GGCCTTCAGCCAGCCTGCAGAGG - Intronic
1061064480 9:128268817-128268839 CACCTTCCTCCTGCCTGCTGTGG - Intronic
1061445077 9:130633004-130633026 GGCCTGCGGCCTGGGTGCTGTGG - Intronic
1061480727 9:130896576-130896598 CCCCTGCATCCCGGCTGCTGGGG + Intergenic
1061836819 9:133334930-133334952 GGCTTTCATTTTAGCTGCTGGGG + Intronic
1061924447 9:133799057-133799079 GGCCTGTAGCCTGGCTTCTGCGG + Intronic
1061999934 9:134210826-134210848 GGTGCTCATTCTGGCTGCTGGGG - Intergenic
1062029440 9:134355638-134355660 GGTCCTCAGCCTGGCTGCAGAGG - Intronic
1062272050 9:135714224-135714246 GGCCTCCATCCTGGCTCTTGGGG + Intronic
1062476278 9:136728904-136728926 GGCCTTCCTCCCGGCCCCTGCGG - Intergenic
1062565875 9:137163760-137163782 GGTCTTCATGCTGGTAGCTGGGG + Exonic
1187449103 X:19381362-19381384 GGGCTTCAGCCAGGCTGCTGGGG + Intronic
1187478328 X:19631540-19631562 GCTCTGCAGCCTGGCTGCTGTGG + Intronic
1188196795 X:27244611-27244633 TGCCTTCATCCTGCAAGCTGAGG + Intergenic
1188828814 X:34870926-34870948 GGCTCTCGTCCTGGCTGTTGTGG - Intergenic
1189656659 X:43251532-43251554 TTCCCACATCCTGGCTGCTGTGG - Intergenic
1192204221 X:69085639-69085661 GGCCTTCCTCCCTGCTGCTTTGG - Intergenic
1192350804 X:70354889-70354911 GGCTTTCTTCCCAGCTGCTGGGG + Intronic
1194057265 X:89151249-89151271 TGCCTTCTCCCTGGCTTCTGAGG + Intergenic
1194212318 X:91083348-91083370 GCCAGGCATCCTGGCTGCTGTGG - Intergenic
1195473586 X:105260252-105260274 GGCCGTCATCCTTGCTGTTTGGG - Intronic
1196943201 X:120797998-120798020 TCCCTTCATCCTGGCAGCTTAGG - Intergenic
1200323340 X:155212761-155212783 GGCCATCATTCTGGCAGATGAGG + Intronic