ID: 1072664639

View in Genome Browser
Species Human (GRCh38)
Location 10:97384532-97384554
Sequence GGTACTTAAGGCCTTCATCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 93
Summary {0: 1, 1: 0, 2: 1, 3: 4, 4: 87}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1072664639_1072664645 0 Left 1072664639 10:97384532-97384554 CCAGGATGAAGGCCTTAAGTACC 0: 1
1: 0
2: 1
3: 4
4: 87
Right 1072664645 10:97384555-97384577 CCCAACCTCAGCTGCCTGGACGG No data
1072664639_1072664650 25 Left 1072664639 10:97384532-97384554 CCAGGATGAAGGCCTTAAGTACC 0: 1
1: 0
2: 1
3: 4
4: 87
Right 1072664650 10:97384580-97384602 ACCCTGAGGACCCCCAACCTCGG No data
1072664639_1072664648 11 Left 1072664639 10:97384532-97384554 CCAGGATGAAGGCCTTAAGTACC 0: 1
1: 0
2: 1
3: 4
4: 87
Right 1072664648 10:97384566-97384588 CTGCCTGGACGGAGACCCTGAGG No data
1072664639_1072664641 -4 Left 1072664639 10:97384532-97384554 CCAGGATGAAGGCCTTAAGTACC 0: 1
1: 0
2: 1
3: 4
4: 87
Right 1072664641 10:97384551-97384573 TACCCCCAACCTCAGCTGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1072664639 Original CRISPR GGTACTTAAGGCCTTCATCC TGG (reversed) Intronic
901957089 1:12794104-12794126 GGTATCTCAGGCATTCATCCTGG - Exonic
901965099 1:12859882-12859904 GGTATCTCAGGCATTCATCCTGG - Exonic
901980489 1:13030236-13030258 GGTATCTCAGGCATTCATCCTGG - Intronic
901988947 1:13097077-13097099 GGTATCTCAGGCATTCATCCTGG + Intergenic
901992866 1:13129690-13129712 GGTATCTCAGGCATTCATCCTGG - Intergenic
902001599 1:13198695-13198717 GGTATCTCAGGCATTCATCCTGG + Intergenic
902020829 1:13344405-13344427 GGTATCTCAGGCATTCATCCTGG + Exonic
905761264 1:40559727-40559749 GGTACCTCAGTCCTTCAGCCTGG - Intergenic
906588890 1:47004969-47004991 AGAAGTTGAGGCCTTCATCCAGG + Intergenic
912276068 1:108260335-108260357 GGTATTTAAGTCCATCATCAGGG + Intergenic
912292160 1:108434023-108434045 GGTATTTAAGTCCATCATCAGGG - Intronic
913608933 1:120492102-120492124 GGTGCTTTAGGCCTTCTGCCTGG - Intergenic
914204898 1:145518349-145518371 GGTGCTTTAGGCCTTCTGCCTGG + Intergenic
914582260 1:149029736-149029758 GGTGCTTTAGGCCTTCTGCCTGG + Intronic
916300490 1:163268449-163268471 TGCATTTAAGGCCTTGATCCTGG + Intronic
916640063 1:166717982-166718004 GGAAGTTGAGGCCTTCATCCAGG + Intergenic
920695437 1:208178475-208178497 GGTATTTTAGGCCTTCCTCAAGG - Intronic
920940407 1:210476968-210476990 GTTACTCATGGCCATCATCCAGG - Intronic
924468091 1:244315952-244315974 GGCATTTGGGGCCTTCATCCTGG - Intergenic
924865651 1:247977159-247977181 GGTACTTAAGAGCATCATCTGGG - Intronic
1067444141 10:46329981-46330003 GGTGCTTGAGGCCTCCCTCCAGG + Exonic
1070465523 10:76719315-76719337 GGTACATAAAGCATTCAACCGGG - Intergenic
1070552493 10:77501721-77501743 GGTACTTGAGGACAGCATCCTGG - Intronic
1072664639 10:97384532-97384554 GGTACTTAAGGCCTTCATCCTGG - Intronic
1072664676 10:97384681-97384703 AGTACTTAGGGCCTTCATCCTGG - Intronic
1072664746 10:97384941-97384963 GGTCCTCAGGGTCTTCATCCTGG - Intronic
1072664784 10:97385054-97385076 GGTCCTCAGGGCCTTCATCCTGG - Intronic
1074125914 10:110528657-110528679 GGTTCTAAAGCCCCTCATCCAGG - Intergenic
1082993708 11:59232141-59232163 AGAAGTCAAGGCCTTCATCCAGG + Intergenic
1085040258 11:73322698-73322720 GGCACTTGAGGCTTTCAACCTGG - Intronic
1086019941 11:82215592-82215614 GGTACATAGATCCTTCATCCTGG + Intergenic
1094605317 12:31944293-31944315 AGAAGTCAAGGCCTTCATCCAGG - Intergenic
1098079016 12:66763747-66763769 GGTACTTAAGTTCTTTGTCCAGG - Intronic
1098532257 12:71554297-71554319 TGGTCTTAAGGCCCTCATCCAGG - Intronic
1101060220 12:100963305-100963327 GGTCCCTGAGGACTTCATCCAGG - Intronic
1107076294 13:36324506-36324528 GGTATCTAAGGGCTTCATCTGGG - Intronic
1109294790 13:60516795-60516817 CCTACTTCAGGCCTTCATCAAGG + Intronic
1125337522 15:38641841-38641863 GGGACTTATGGCCTTTATCCAGG - Intergenic
1127679200 15:61276148-61276170 GGTACTGAAAGGCTTCATTCCGG + Intergenic
1131070643 15:89463648-89463670 AGAAATCAAGGCCTTCATCCAGG + Intergenic
1134214754 16:12308356-12308378 GGTATTTACGGATTTCATCCAGG + Intronic
1136128694 16:28204648-28204670 CGAACTTAGTGCCTTCATCCAGG - Intronic
1140440514 16:74984469-74984491 GGTTCTTAATGCCATCATACTGG - Intronic
1141395012 16:83696868-83696890 GGCACTGAAGGGCTTCATCAGGG - Intronic
1141608223 16:85167691-85167713 GGGACTTTGGGCCTTCACCCTGG - Intergenic
1144718759 17:17453129-17453151 TGTTCTTAAGGCCTACTTCCAGG - Intergenic
1144767866 17:17742719-17742741 GGTCCTTTAGACCTTCCTCCAGG + Intronic
1151702584 17:75751217-75751239 GGCACTCGAGGCCTTCATCCTGG + Intronic
1155826877 18:30456282-30456304 GGCACTTAATGCTTTCATCTTGG - Intergenic
1158523563 18:58192470-58192492 GGTATTTAAGGGCATCATCAGGG + Intronic
1160437880 18:78865827-78865849 GGTCCTAATGGCCTTCACCCTGG - Intergenic
1160437917 18:78865964-78865986 GGTCCTAATGGCCTTCACCCTGG - Intergenic
1168720411 19:58551663-58551685 GGTTCTTAAGCCGTTCCTCCAGG + Exonic
935188762 2:100758697-100758719 AGCACTCAAGGCCTTGATCCTGG + Intergenic
935665353 2:105507415-105507437 CCTACTTCAGCCCTTCATCCTGG - Intergenic
936572314 2:113627184-113627206 GGTCCTTCAGGCCTTCGGCCGGG + Intergenic
940043094 2:149380752-149380774 GGTATTTAAAGCCATCAGCCTGG + Intronic
943166710 2:184337106-184337128 GGCACTAAAGGCCTTTGTCCTGG - Intergenic
1169883695 20:10374596-10374618 GGTACTTAAAGCCATGATACAGG + Intergenic
1169921099 20:10735125-10735147 GATACTTAAGGGCTTAATTCAGG - Intergenic
1178265582 21:31140165-31140187 GATACTAAAGGCCATTATCCAGG - Intronic
1181174692 22:21028904-21028926 GGACCTTAGGACCTTCATCCAGG - Exonic
1183313892 22:37126891-37126913 GGTAATTAATTCGTTCATCCAGG + Exonic
1185427874 22:50783696-50783718 GGTCCTTCAGGCCTTCGGCCGGG - Intergenic
957718915 3:83969393-83969415 AGAAGTCAAGGCCTTCATCCAGG + Intergenic
959005795 3:101018388-101018410 GGTACTTAAGGTGTTTATACAGG - Intergenic
967506491 3:190258665-190258687 GGCACATAAGGCCTGCATTCAGG - Intergenic
971721885 4:30255704-30255726 GGGACTCAAGGCCTTCCACCTGG + Intergenic
981011893 4:139933573-139933595 GCTTCTCAAGGCCTACATCCTGG + Intronic
987337820 5:16912517-16912539 GGTACATAATGCCTCCATTCAGG + Intronic
993972893 5:94441665-94441687 GCTAGTGAAGGCCTTCTTCCAGG - Intronic
994187794 5:96835004-96835026 AATACTAAAGGCCCTCATCCTGG - Intronic
997882320 5:137601901-137601923 GGTTCTTAAGGCTGTAATCCTGG - Intergenic
1000044561 5:157511386-157511408 TGTAATTTGGGCCTTCATCCTGG - Intronic
1000870648 5:166573156-166573178 GGTACTCTAGGTCTTCATCAAGG + Intergenic
1006525366 6:34600042-34600064 GGAAGTTAATGCCGTCATCCAGG - Intronic
1008882519 6:56395166-56395188 GGGACTTAAGGCCTGCCACCTGG - Intergenic
1012065333 6:94543309-94543331 GGTACATAAATCCTTCATACAGG - Intergenic
1013162044 6:107554219-107554241 GTTTCTCAAGGCCTACATCCTGG - Intronic
1015691734 6:135932041-135932063 GGTCCTTAGGGCCTGAATCCAGG - Intronic
1015739125 6:136434390-136434412 AGTAATTAAGGCTATCATCCTGG + Intronic
1027439191 7:78199571-78199593 GGTACTAAAGGCATTCTACCTGG - Intronic
1028317488 7:89421534-89421556 GGTATTTAAGCACTTCATCTTGG + Intergenic
1030143914 7:106333222-106333244 AGAAGTTGAGGCCTTCATCCAGG + Intergenic
1033435393 7:141329097-141329119 GGTACTTGAGGCATTGATTCTGG + Intronic
1033672908 7:143510823-143510845 GGGACTCAAGGACTGCATCCAGG - Intergenic
1036827333 8:11987461-11987483 GGTGCTCAAGGCCTGCCTCCTGG - Intergenic
1047384250 8:124394939-124394961 GGGACTCAAGGCCTTCCTTCTGG + Intergenic
1048931352 8:139317788-139317810 GGTATTTAAGGCCTCTATTCAGG + Intergenic
1053412940 9:37927486-37927508 TTTACTGAAGGCCTTCACCCTGG - Intronic
1195326257 X:103761021-103761043 GGTCCTTCAAGCTTTCATCCAGG - Intergenic
1196031381 X:111097744-111097766 GGTACTTGAGGCCTCCAATCAGG + Intronic
1196401167 X:115318159-115318181 AGAAGTTGAGGCCTTCATCCAGG - Intergenic