ID: 1072664640

View in Genome Browser
Species Human (GRCh38)
Location 10:97384544-97384566
Sequence GCTGAGGTTGGGGGTACTTA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 264
Summary {0: 1, 1: 1, 2: 4, 3: 40, 4: 218}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1072664640_1072664650 13 Left 1072664640 10:97384544-97384566 CCTTAAGTACCCCCAACCTCAGC 0: 1
1: 1
2: 4
3: 40
4: 218
Right 1072664650 10:97384580-97384602 ACCCTGAGGACCCCCAACCTCGG No data
1072664640_1072664653 21 Left 1072664640 10:97384544-97384566 CCTTAAGTACCCCCAACCTCAGC 0: 1
1: 1
2: 4
3: 40
4: 218
Right 1072664653 10:97384588-97384610 GACCCCCAACCTCGGCAGCCAGG No data
1072664640_1072664648 -1 Left 1072664640 10:97384544-97384566 CCTTAAGTACCCCCAACCTCAGC 0: 1
1: 1
2: 4
3: 40
4: 218
Right 1072664648 10:97384566-97384588 CTGCCTGGACGGAGACCCTGAGG No data
1072664640_1072664657 25 Left 1072664640 10:97384544-97384566 CCTTAAGTACCCCCAACCTCAGC 0: 1
1: 1
2: 4
3: 40
4: 218
Right 1072664657 10:97384592-97384614 CCCAACCTCGGCAGCCAGGACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1072664640 Original CRISPR GCTGAGGTTGGGGGTACTTA AGG (reversed) Intronic
900625570 1:3607083-3607105 GCCGGGGTTAGGGGTACTGAGGG + Intronic
902054112 1:13585873-13585895 GCTGGGCTGGGGGGTAATTATGG + Intronic
902849741 1:19145228-19145250 CCTGAGGTTGGGGGATATTAGGG - Intronic
902973150 1:20070006-20070028 ACTGAGGTAGGGGTTACTTCGGG + Intronic
903951082 1:26996287-26996309 GCTGAGGCTTGGGGCCCTTATGG + Intronic
906181087 1:43819695-43819717 GCTGAGGTTTGGAGTACAGATGG + Intronic
907243199 1:53091936-53091958 GCTGAGGTTTGGGATCCTTAAGG + Intronic
908831179 1:68180017-68180039 GCTGAGGGAGGGGGAAGTTAAGG + Intronic
915063887 1:153209019-153209041 GCTGGGGCTGGGAGTAATTATGG - Intergenic
918470290 1:184865523-184865545 GCTGAGGTTTGGGGTATGAATGG - Intronic
1062963565 10:1591346-1591368 GCTGTGGGTGGGGGTACGAAGGG - Intronic
1065122698 10:22544319-22544341 GGTGGGGGTGGGGGTGCTTATGG + Intronic
1066435119 10:35390683-35390705 GCTGAGCTGGGGGTTACTGAGGG - Intronic
1066631422 10:37462464-37462486 CATGAGGTTGGGGGTGATTATGG - Intergenic
1067854040 10:49776249-49776271 GCTGAGGTTTGGGATACAAATGG - Intergenic
1068347292 10:55798261-55798283 ACTGAGGTGGGGAGTACTGATGG + Intergenic
1070399936 10:76044644-76044666 GATGAGGTTGGGAGTACAGAGGG - Intronic
1070571145 10:77639853-77639875 GCCGAGGTTGGAGGTACTATGGG - Intergenic
1071317467 10:84416178-84416200 GCAGAGGTTGGGGGTTCCTTTGG + Intronic
1072664515 10:97384097-97384119 GCTGAGGTTGGGGGTGCTCAGGG - Intronic
1072664526 10:97384134-97384156 GCTGAGGTTGGGGGTGCTCAGGG - Intronic
1072664537 10:97384171-97384193 GCTGAGGTTGGGGATGCTCAGGG - Intronic
1072664574 10:97384318-97384340 GCAGAGGTTGGGGGTCCTCAGGG - Intronic
1072664612 10:97384431-97384453 GCCGAAGTTGGGGGTCCTCAGGG - Intronic
1072664640 10:97384544-97384566 GCTGAGGTTGGGGGTACTTAAGG - Intronic
1072664651 10:97384581-97384603 GCCGAGGTTGGGGGTCCTCAGGG - Intronic
1072664663 10:97384618-97384640 GCCGAGATTGGGGGTCCTCAGGG - Intronic
1072664677 10:97384693-97384715 GCTGAGGTTGGGAGTACTTAGGG - Intronic
1072664687 10:97384730-97384752 GCCGAGGTTGGGGGTCCTCAGGG - Intronic
1072664699 10:97384767-97384789 GCCGAGATTGGGGGTCCTCAGGG - Intronic
1072664747 10:97384953-97384975 GCTGAGGTGGGGGGTCCTCAGGG - Intronic
1072664786 10:97385066-97385088 GCCGAGGTGGGGGGTCCTCAGGG - Intronic
1072782757 10:98261537-98261559 GCTAGGGTTGGGGGTTCTTGTGG - Intronic
1073026880 10:100494215-100494237 TGTGTGGTTGGGGGTACTGAGGG - Intronic
1073735044 10:106336074-106336096 CCTGGGGTTTGGGGTTCTTATGG - Intergenic
1075719544 10:124576698-124576720 GCTGAGGGCGGGGGTACTGGGGG + Intronic
1078415392 11:11160674-11160696 GCTGAGTTGGGGGCTTCTTATGG - Intergenic
1078846854 11:15126265-15126287 GCTGAGGCTAGGAGTACTTCTGG + Intronic
1079036658 11:17026015-17026037 GCTGAGGTTGTGTGCACTTAAGG - Intergenic
1079724206 11:23859812-23859834 GCTGAGGTTTGGGGTATGGATGG - Intergenic
1079982784 11:27168934-27168956 GCTGAGGTTTGTGGTACAAATGG + Intergenic
1081012679 11:37834917-37834939 GCTGAGGTTTGGGGTACATGTGG + Intergenic
1082226900 11:49718694-49718716 GTTGAGATTGAGGTTACTTATGG + Intergenic
1082961809 11:58925038-58925060 GTTGAGGCTGTGGGTCCTTAGGG + Intronic
1083014252 11:59436506-59436528 GCTGGGGTTGGGGGTAAATTGGG - Intergenic
1083331397 11:61900036-61900058 GCTGAGAGTGGGGGCACTAATGG + Intronic
1084437971 11:69155174-69155196 GCTGATGGTGGGGGGACTTGGGG + Intergenic
1085302383 11:75466197-75466219 GCTGGGGTTGGGGCAACCTAGGG + Intronic
1086622520 11:88904388-88904410 GTTGAGATTGAGGTTACTTATGG - Intronic
1088071288 11:105788746-105788768 GATGAGGTTGGGGATAGTGAGGG + Intronic
1088521992 11:110711387-110711409 GCTGTGGTTGGGGGTCCTGAGGG - Intronic
1088691814 11:112334819-112334841 GCTGAGGCTGGAGGTGCTGATGG + Intergenic
1090041947 11:123299308-123299330 GCTGAGTCTGGGGGTTTTTATGG - Intergenic
1091006074 11:131955148-131955170 GCTGAGGGTGGAGGTGCTCAGGG - Intronic
1093769077 12:22998810-22998832 CCTGGGGTTTGGGGTTCTTATGG - Intergenic
1094698867 12:32848719-32848741 GCTGAGGTTTGGGATACGAATGG - Intronic
1096052021 12:48618701-48618723 GCTCAGGTTGGGGCTGGTTAAGG - Intergenic
1096643791 12:53016523-53016545 GCTGAGGATGGGGGTACTGGTGG + Exonic
1099474325 12:83089547-83089569 GTTTAGTTTCGGGGTACTTATGG - Intronic
1100460986 12:94799060-94799082 TCTGAGGTTTGGGGTTCTGAAGG - Intergenic
1100554283 12:95677000-95677022 GCTGAGGTGGGTGGATCTTAAGG + Intronic
1101285255 12:103305313-103305335 GATGACGGTGGTGGTACTTATGG - Intronic
1103285011 12:119793593-119793615 GTTTGGGTAGGGGGTACTTAAGG - Intronic
1103322911 12:120102125-120102147 GCAGAGGTTGGGGGCACTCAGGG - Intronic
1106657060 13:31757769-31757791 GCTGATGTTGGGTGTGATTATGG + Intronic
1108316710 13:49243747-49243769 GCTGATGCTGGTGGTGCTTATGG - Intergenic
1111615566 13:90658400-90658422 GCTGAGGATGGGGGTTCCTTTGG - Intergenic
1112446072 13:99465476-99465498 GCTGAGGTAGGGCGTTCTGAAGG + Intergenic
1115372507 14:32633818-32633840 GCTGAGGTTGGGGAAACACATGG - Intronic
1116688616 14:48075870-48075892 GCTGAGGTAGGGGGAAGTTCTGG + Intergenic
1117413136 14:55468579-55468601 GCTGAGTCTGGGGGTTTTTATGG + Intergenic
1118810048 14:69266686-69266708 GCTGCTGTTGGGAGCACTTATGG - Intronic
1121919905 14:97870861-97870883 GATGGGGTTGGGGGTACATCAGG + Intergenic
1122628559 14:103097119-103097141 GCTGAGGCTGGGGGTAGGGAGGG + Intergenic
1123017272 14:105381369-105381391 GCTGAGGCAGGGGCTACTCAGGG - Intronic
1124993878 15:34703857-34703879 GCTGAGGTTGTGAGCAGTTAAGG + Intergenic
1125205120 15:37145491-37145513 GCTGAGGTTTGAGGTACAAATGG - Intergenic
1126956136 15:53935717-53935739 GCTGAGGGTGGGGGCTCTTCTGG - Intergenic
1129688385 15:77699137-77699159 GCTAATGTTGGGGGTAGATAGGG - Intronic
1129723437 15:77890052-77890074 GCTGGGCTTGGGGGTTCCTATGG + Intergenic
1130394483 15:83490143-83490165 GATGAGGTTGGGGCCCCTTAGGG + Intronic
1132555128 16:568919-568941 TCTGAGGTTGGGGACATTTAGGG - Exonic
1133428600 16:5715710-5715732 GCTGAGGTTGGGGGCAGCTTTGG + Intergenic
1134602358 16:15543290-15543312 CCTGGGGTTTGGGGTTCTTAAGG + Intronic
1134862777 16:17575495-17575517 GGTGGGGTAGGGGGTCCTTATGG - Intergenic
1135729050 16:24879277-24879299 GCTGAGGTCTGGGGTACGAATGG + Intronic
1136248626 16:28989447-28989469 GCTGAGGTTGGGGGTTCTCTGGG + Intronic
1136547919 16:30965810-30965832 GAGGAGGTGGGGGGTACTCAGGG - Exonic
1140339642 16:74145046-74145068 GCTGAGGTTTGGGGTACATTAGG + Intergenic
1140457551 16:75113939-75113961 GCTGAGGATGGGGGCAGTCAGGG - Intronic
1141335829 16:83154320-83154342 GCTGAGGCTGGGGGTTCACAAGG + Intronic
1141860915 16:86715623-86715645 GCTGAGGTTTGGGGTATAGATGG + Intergenic
1142639297 17:1276387-1276409 GCTGGGGTCGGGGGTAATTAGGG - Intergenic
1142650974 17:1351713-1351735 GCTGAGGTTGGGGGATCTTGAGG - Intronic
1144558492 17:16302432-16302454 GCTGAGGTTGGAGGTTGTCATGG + Intronic
1146912720 17:36658582-36658604 GGTGAGGTGGGGGGTGCTTGTGG + Intergenic
1148006485 17:44435184-44435206 GCTAATCTTGGGGGTACTTTAGG - Intronic
1148184373 17:45631097-45631119 GCTGAAGTTGGGGATTCTTGTGG - Intergenic
1148189836 17:45670882-45670904 GCTGAGGTTGGGTGGGCTTAGGG + Intergenic
1149386985 17:56152145-56152167 GCTGAGGTTGGGGATAGTAATGG + Intronic
1151030284 17:70730016-70730038 GCTGAGGTTTGGGGTACGAATGG - Intergenic
1152200663 17:78944040-78944062 GCTGAGGTTTGGGAGACTGAGGG + Intergenic
1154224070 18:12485337-12485359 GCTGAGGTGGGCGGATCTTAAGG - Intronic
1155462014 18:26093254-26093276 CCTGAGCTAGGGGATACTTAGGG + Intergenic
1157155414 18:45260914-45260936 GCTGAGGTTTGGGGTACGGATGG - Intronic
1158771213 18:60519913-60519935 GGTGAGGTTGGGCATACTGACGG - Intergenic
1161810998 19:6471344-6471366 GCTGAGGCTGGGGGTGCTGGTGG + Intronic
1162031013 19:7917261-7917283 GCTGGGATTTGGGGTCCTTAGGG + Intronic
1164585554 19:29470976-29470998 CCAGAGGTTGGGGGTAGTAAAGG + Intergenic
1164730425 19:30500014-30500036 GGTGAGCTTGGGAGTACTTCTGG - Intronic
1164756680 19:30695058-30695080 GCTGAGATTGGGGTTACTAAAGG + Intronic
1166222918 19:41377063-41377085 GCTGGGGTTGAGGGTGTTTATGG + Intronic
1166421212 19:42638662-42638684 GCTGAGGTTTGGGGTACAAATGG + Intronic
1167483399 19:49746453-49746475 GCTGAGGTGGGCGGGACCTAGGG - Exonic
925349783 2:3192741-3192763 GCTGAGGTTGGGTTTACTGCAGG + Intronic
926736222 2:16075044-16075066 GCTGAGGTTGGGGGTACAAATGG + Intergenic
932246505 2:70201325-70201347 GCTGAGGTTTGGGGTATGAATGG + Intronic
932907242 2:75767332-75767354 GATGAGGTTGGGGGTAAATAGGG + Intergenic
934958117 2:98641758-98641780 GCTGAGGTTGGGGGATCATGAGG + Intronic
935809821 2:106786783-106786805 ACTGGGGTTGGGGGTATTTTAGG - Intergenic
936629992 2:114191890-114191912 GCTGAGGTTTGGGGTACAGATGG - Intergenic
936745470 2:115571299-115571321 GCTGAGGTTTGGGGTAAGAATGG + Intronic
937637705 2:124175511-124175533 ACTTAGGTTTGGGGTACATATGG + Intronic
938722293 2:134077399-134077421 GCTGAGGTTTGGGGTACGAATGG - Intergenic
939460091 2:142488138-142488160 TCTGTGGTTTGGGGTTCTTAAGG - Intergenic
939461409 2:142500566-142500588 GCTGGGGTTGTGGGGACTCAAGG - Intergenic
939776164 2:146390852-146390874 TCTGGGGTTTGGGGTTCTTATGG + Intergenic
941143302 2:161812435-161812457 GCTGAGGTTTGGGGTACAGATGG + Intronic
942582187 2:177430589-177430611 GCTGGGGGTGGGGGTTCTTTTGG + Intronic
944351851 2:198737371-198737393 ACTGAGGCTGGGGGCACTGAGGG + Intergenic
948501422 2:238397674-238397696 GCAGAGGTGGGGGGTAGTAATGG + Exonic
948501438 2:238397718-238397740 GCAGAGGTGGGGGGTAGTAATGG + Intronic
948501454 2:238397762-238397784 GCAGAGGTGGGGGGTAGTAATGG + Intronic
948501510 2:238397938-238397960 GCTGAGGTGGGGTGTAGTAATGG + Intronic
948535814 2:238645938-238645960 GGTGAGGGTGGTGGCACTTATGG - Intergenic
948644850 2:239398060-239398082 GCTGGGGATGGGGGAACTGAAGG - Intronic
1169804536 20:9545770-9545792 GCTGAGTTTGGAAGTACTTGTGG - Intronic
1170376106 20:15701732-15701754 GCTGAGGTTTGGGGTGCAGATGG + Intronic
1170902472 20:20478781-20478803 GCTGAGGTTTGGGGTATGAATGG - Intronic
1171527282 20:25824725-25824747 GCTGAGGTGGGGGTCACTTGAGG + Intronic
1171549544 20:26031159-26031181 GCTGAGGTGGGGGTCACTTGAGG - Intergenic
1172788868 20:37488503-37488525 GCTGAGCTTGGGAGAACTGAAGG + Intergenic
1172938423 20:38637798-38637820 GCTGGGGTAGGGGCGACTTACGG - Exonic
1173268320 20:41507816-41507838 GCTGAGGTTGAAGGTAAATAGGG - Intronic
1175671652 20:60908535-60908557 GCTGAGGTTTGGGATACAGATGG + Intergenic
1178376036 21:32068129-32068151 ACTAAGTTTGGGGGTACATAGGG - Intergenic
1183369036 22:37422120-37422142 GCTGGGGTTGGGGGCGCCTAAGG - Intronic
1184048907 22:41989840-41989862 GCTGAGGTTGGTGGTATCTGGGG + Intronic
1203292014 22_KI270736v1_random:3799-3821 GCTGAGTTTGGGGCTGCTTATGG - Intergenic
949218844 3:1605296-1605318 GTTGAGGTTTGGGGTACAGAAGG + Intergenic
950196983 3:11016259-11016281 ACAGAGGTTGAGTGTACTTAAGG + Intronic
951096050 3:18632606-18632628 GCTGAGGTTGGGGGTACAACTGG - Intergenic
951134109 3:19083587-19083609 TCTGGGGTTTGGGGTTCTTATGG - Intergenic
951501316 3:23390288-23390310 GCTGAGGTTTGGGGTTAATATGG - Intronic
952193882 3:31052196-31052218 GCTGAGGTTTGGGCTTCTAATGG - Intergenic
953809106 3:46096784-46096806 GCTGAGGTTTGGTGTACCAATGG + Intergenic
955148916 3:56347584-56347606 GCTGGGATTGGGGGTCTTTAAGG - Intronic
956613355 3:71146453-71146475 CCTGAGATTGGGGGAAGTTAAGG + Intronic
957372737 3:79316534-79316556 GATGAGGTGGGGGGAACTTTTGG + Intronic
959471710 3:106760476-106760498 GCTGAGGTTTGGGGTAGGAATGG - Intergenic
960442541 3:117706778-117706800 GCAGAGGGTGGGGGAAGTTAAGG + Intergenic
961100033 3:124190898-124190920 TCTGAAGTTGGGGACACTTAGGG - Intronic
962309997 3:134318918-134318940 GCTGAGGTTGGGGGATCATGAGG + Intergenic
962565637 3:136656265-136656287 GCTGGGGTTGGGGGCACTGAAGG + Intronic
962728336 3:138256315-138256337 GCTTTGGTTGGGGGTACAAATGG - Intronic
963541897 3:146602121-146602143 GTTCAGGGTGGGGGTACTTGCGG - Intronic
964364755 3:155938002-155938024 GGTGAATTTGGGGGTAATTATGG + Exonic
965734644 3:171808146-171808168 GCTGAGGTTGGGGGTACAACTGG - Intronic
965773969 3:172209518-172209540 GCTGAGTCTGGGGGTTTTTATGG + Intronic
974260268 4:59517836-59517858 GCTGAGTCTGGGGGTTTTTAAGG + Intergenic
974452344 4:62082220-62082242 GCTGAGGTTTGGGGTAAGAATGG + Intergenic
975072008 4:70153310-70153332 GCTGAGGTTTGGGGTATGGATGG + Intronic
976802366 4:89006949-89006971 GCTGAGGTCTGGGGTTCATATGG + Intronic
979099827 4:116599812-116599834 GTTGGGGTTGGGGAGACTTAGGG + Intergenic
981504777 4:145487267-145487289 GCTAAAGTTTGGGGTATTTAGGG + Intronic
982049671 4:151488240-151488262 GCTGAGGTTTGGGGTATAAATGG + Intronic
983677289 4:170310283-170310305 GCTGAGGTTTGGAGTACAAATGG - Intergenic
984221469 4:176982938-176982960 GCTGAGGTTTGGGGTATAAAAGG + Intergenic
984624756 4:181994274-181994296 GGTGGGGTAGGGGGTAGTTAAGG + Intergenic
984762307 4:183373201-183373223 GCTGAGGTTTGGGGCACTTATGG - Intergenic
985227462 4:187778043-187778065 TCTGAGTTTGGGGGTTTTTATGG + Intergenic
985656397 5:1133754-1133776 GCTGAGGTTGGGGGCAGCTCAGG + Intergenic
986043616 5:4016848-4016870 GCTGGGGCTGAGGGCACTTATGG - Intergenic
986163220 5:5250074-5250096 TCTGAGGTTTGGGGTTCTTATGG + Intronic
987244941 5:16039225-16039247 GCTGAGGTTTTGGGCACTTTTGG - Intergenic
990176983 5:53118881-53118903 GCTGAGCTTGGGGCTTTTTATGG + Intergenic
992653775 5:78887856-78887878 GCTGAGGTTGACCGTACTTGTGG - Intronic
993514270 5:88810981-88811003 GTTCAGGTTGGGGATAATTAAGG + Intronic
993948805 5:94148288-94148310 GCTTAGGTTGCCTGTACTTATGG - Intergenic
996023133 5:118613690-118613712 GCTGAGTTTGGGGGCTCTTAGGG - Intergenic
996836008 5:127793063-127793085 GCTGAGGTTTGGGGTATGAATGG - Intergenic
997432052 5:133847577-133847599 GCTGAGGTTTGGAGGACTTCTGG - Intergenic
997559047 5:134828862-134828884 ACTGATTGTGGGGGTACTTACGG - Exonic
997941267 5:138159648-138159670 CCTGAGGTTTGGGGTGCTTGTGG - Intronic
1007839095 6:44701145-44701167 GCTGAGGTTGAGGGTTCAAACGG + Intergenic
1008359161 6:50594181-50594203 GCTGAGGTTTGGGGTACAAATGG - Intergenic
1009461921 6:63923647-63923669 GCTGAGGTTGGGAGTACGACTGG + Intronic
1011129580 6:84039781-84039803 GCTGAGGGAGGGGCTTCTTAAGG + Intronic
1012532028 6:100249812-100249834 GCTGTGGGTGGGGGTACTATTGG + Intergenic
1012537808 6:100320316-100320338 GCTGAGATTTGGGGTATTAATGG + Intergenic
1013269892 6:108535675-108535697 GCTGCGGTTGGAAGTACTGAGGG + Intergenic
1013300962 6:108804554-108804576 ACTGAACTTGGGGGTCCTTAAGG - Intergenic
1013391297 6:109688850-109688872 GATGAGATTGGGGGTGCTCAGGG + Intronic
1014384678 6:120785958-120785980 GAGGAGGCTGGGGGTACTGAGGG + Intergenic
1015334873 6:132025571-132025593 GCTGAGGTTGTGGGTGCATGCGG + Intergenic
1017296519 6:152802174-152802196 GCTGAGGTTTGGGATACAGATGG + Intergenic
1018277528 6:162148956-162148978 GGCCAGGGTGGGGGTACTTACGG + Intronic
1018431348 6:163725295-163725317 GCAGGGGTTGGGGGGACTTCAGG + Intergenic
1021519880 7:21528498-21528520 GCTGAGGTAGGGTGGACTTGAGG - Intergenic
1021787443 7:24165564-24165586 GCTGAGTCTGGGGGTTTTTATGG + Intergenic
1021970937 7:25965388-25965410 GCTGAGGTAGGGTGGACCTAGGG - Intergenic
1024557141 7:50613514-50613536 TCTGAGGTCGGGGGTTCTTCTGG - Intronic
1024814645 7:53254836-53254858 GCTGAGGTTTGGGGTACAATTGG + Intergenic
1026253351 7:68689962-68689984 GTTGTGGTTGGGGGTGGTTACGG - Intergenic
1026469206 7:70680570-70680592 GCTGAGTTTGGGGGTGCATGAGG - Intronic
1027495694 7:78885230-78885252 GCTGAGGTTTGGGGTAGGAATGG - Intronic
1029958744 7:104667812-104667834 GCTGAGGATGGGGGTACTGGTGG + Intronic
1030830323 7:114211437-114211459 GCTGAGGGTGGGGGTTCCTTTGG + Intronic
1030978459 7:116156519-116156541 GCTGAGGATGGGTGTAGTTATGG - Intronic
1031351270 7:120734427-120734449 GCTTAATTTGGGGGTACTTGAGG - Intronic
1031836475 7:126685981-126686003 GCTGAGTCTGGGGGTTTTTATGG - Intronic
1031999235 7:128254042-128254064 GCTGGGGGTGGGGGTGCTTATGG + Intronic
1036120386 8:6011165-6011187 ACTGAGGTTTGGGGTACCTCTGG - Intergenic
1036950683 8:13136248-13136270 GCTGAGGTTTGGGGTACGATTGG + Intronic
1038960616 8:32514897-32514919 GCTGAGGTTTGGGGTATGAATGG + Intronic
1039228794 8:35419966-35419988 GCTGAGTCTGGGGGTTTTTATGG + Intronic
1040528261 8:48243393-48243415 GCTGAGGTAGGTGGTACATGTGG + Intergenic
1041723647 8:60998560-60998582 GCTGAGCTTGGGGGTACTGTAGG + Intergenic
1043737733 8:83768688-83768710 GCTGAGTCTGGGGGTTTTTATGG + Intergenic
1043983342 8:86665815-86665837 GCTGAGGTTTGGGGTACGATTGG - Intronic
1044270270 8:90234298-90234320 GCTAAGGTTGTAGGTACTTCAGG + Intergenic
1044322599 8:90821191-90821213 GTTGAGATTGGGGGTACCTGTGG - Intronic
1046954623 8:120050334-120050356 GCTATGGTTGGGGGTAGTTAGGG + Exonic
1047582239 8:126228925-126228947 GCTGAGGTTTGGGCTTCTGATGG + Intergenic
1049253720 8:141603059-141603081 GGTGAGGATGGGGGAACTGAAGG - Intergenic
1049284747 8:141768516-141768538 GCTGAGGCTGGGGGCACTGCAGG - Intergenic
1049702341 8:144020938-144020960 ACTGAGGGTAGAGGTACTTAAGG - Intronic
1049747720 8:144270053-144270075 ACTGAGGTTGGGGGTTCATGTGG - Intronic
1050163843 9:2744309-2744331 GCTAAGTTTGGGGGTTGTTATGG + Intronic
1050451844 9:5789941-5789963 GCTCACTTTGGGGGTACTTTGGG - Intronic
1050776552 9:9269841-9269863 CCTGAGGTTGGGGGTGGTTGGGG + Intronic
1051193106 9:14535018-14535040 GCTGAGATTTGGGGTATTTTAGG - Intergenic
1056188473 9:84160938-84160960 GCTGAGGTTGGCTGGACTGATGG + Intergenic
1057563312 9:96146070-96146092 GCTGAGGATGGGGGTACTGGTGG + Intergenic
1057813646 9:98278030-98278052 GCTTAGGCTGGGGGAACTTGGGG + Intergenic
1058873577 9:109223064-109223086 GCTCTGGTTGGGGGTACATGTGG - Intronic
1185887985 X:3799922-3799944 GCTGAGGTTTGGGCTCCTAATGG + Intergenic
1188221020 X:27541757-27541779 GCTGAGGTTTGGTGTACAAAGGG + Intergenic
1190299343 X:49047482-49047504 GGTGAAGTTGGGGGTATTTAGGG + Intergenic
1190730592 X:53223197-53223219 GCTGACGTAGGGGGTAGTTGAGG - Intronic
1190985101 X:55492568-55492590 GCTGAGGTTGGACCTACTCAGGG - Intergenic
1195275555 X:103276904-103276926 GCCGGGGTTGGGGGTGCTGAGGG - Intergenic
1195457811 X:105089271-105089293 GTTGAGGTTGGGGATAATAAGGG - Intronic
1195898260 X:109771054-109771076 GCTGGGGTTGGGGGTGGTCAGGG + Intergenic
1196080087 X:111621404-111621426 GCTGAGGATGGGGGTACTGGTGG - Intergenic
1196151915 X:112383904-112383926 GCTGAGGTTTGGGATACAAACGG - Intergenic
1197032106 X:121828873-121828895 GCTGAGGTTTGGGGTATGAATGG - Intergenic
1197143244 X:123140293-123140315 GTGGAGGTTGGGGGGACATATGG - Intergenic
1197180756 X:123533608-123533630 GCTGGGGTTGGGGGTTCCTTTGG + Intergenic
1197871818 X:131068620-131068642 GCTGAGGGTGGGGGTGCGGAGGG - Intronic
1198132222 X:133707282-133707304 GCTGAGGTTTGGGGTATGGATGG - Intronic
1199414668 X:147567667-147567689 GCTGAGGTTTGGGGTGCAGATGG + Intergenic
1201975782 Y:19847473-19847495 GCTGAGGTCTGGGGTTTTTATGG - Intergenic
1202584527 Y:26409267-26409289 GCTGAGGCTGGGGGTTGTTCAGG + Intergenic