ID: 1072664642

View in Genome Browser
Species Human (GRCh38)
Location 10:97384553-97384575
Sequence GTCCAGGCAGCTGAGGTTGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 928
Summary {0: 1, 1: 1, 2: 8, 3: 82, 4: 836}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1072664642_1072664648 -10 Left 1072664642 10:97384553-97384575 CCCCCAACCTCAGCTGCCTGGAC 0: 1
1: 1
2: 8
3: 82
4: 836
Right 1072664648 10:97384566-97384588 CTGCCTGGACGGAGACCCTGAGG No data
1072664642_1072664657 16 Left 1072664642 10:97384553-97384575 CCCCCAACCTCAGCTGCCTGGAC 0: 1
1: 1
2: 8
3: 82
4: 836
Right 1072664657 10:97384592-97384614 CCCAACCTCGGCAGCCAGGACGG No data
1072664642_1072664653 12 Left 1072664642 10:97384553-97384575 CCCCCAACCTCAGCTGCCTGGAC 0: 1
1: 1
2: 8
3: 82
4: 836
Right 1072664653 10:97384588-97384610 GACCCCCAACCTCGGCAGCCAGG No data
1072664642_1072664660 27 Left 1072664642 10:97384553-97384575 CCCCCAACCTCAGCTGCCTGGAC 0: 1
1: 1
2: 8
3: 82
4: 836
Right 1072664660 10:97384603-97384625 CAGCCAGGACGGAGACCCTGAGG No data
1072664642_1072664650 4 Left 1072664642 10:97384553-97384575 CCCCCAACCTCAGCTGCCTGGAC 0: 1
1: 1
2: 8
3: 82
4: 836
Right 1072664650 10:97384580-97384602 ACCCTGAGGACCCCCAACCTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1072664642 Original CRISPR GTCCAGGCAGCTGAGGTTGG GGG (reversed) Intronic
900365936 1:2312017-2312039 TTCCAGGGAGCTGAGGCTGGAGG - Intergenic
900417982 1:2543736-2543758 CTCCAGGCAGGGGAGGTAGGCGG - Intergenic
900603851 1:3515242-3515264 GGCCAGGAAGCTCAGGATGGGGG - Intronic
900629106 1:3624561-3624583 TGCCGGGGAGCTGAGGTTGGAGG - Intergenic
900930780 1:5735745-5735767 TTCCAGGCAGGTAAGGTTAGAGG + Intergenic
900994532 1:6113313-6113335 GTTCAGGAAGCTGAGGTGGGAGG + Intronic
901051675 1:6428646-6428668 GGCCGGGCAGCTGAGGATGCTGG - Intronic
901053267 1:6436579-6436601 GTCCAGGAAGTTGAGGCTGCAGG - Intronic
901822347 1:11838218-11838240 CTCCAGGCTGCTGAGGCAGGTGG - Intronic
902176851 1:14656933-14656955 GGCCAGGAAACTGAAGTTGGCGG + Intronic
902190314 1:14758272-14758294 GTTCAGGAGGCTGAGGTGGGAGG - Intronic
902351493 1:15858833-15858855 GTTCAGGAGGCTGAGGTGGGAGG + Intronic
902482648 1:16719715-16719737 GGCCGGGCAGCTGAGGATGTTGG + Intergenic
902857950 1:19222733-19222755 GTCCAGGGAGCTGAAGGCGGTGG + Exonic
903014269 1:20351701-20351723 GTCCAGGAGACTGAGGTGGGAGG + Intronic
903282216 1:22256441-22256463 ATCCAGGCAGGAGAGGATGGTGG + Intergenic
903902749 1:26659911-26659933 GTCCAGGAGGCAGAGGTTGCAGG - Intergenic
903931239 1:26863703-26863725 GCCCAGGCGGATGGGGTTGGTGG - Exonic
903985890 1:27228075-27228097 ATTCAGGAAGCTGAGGTGGGTGG + Intergenic
904253749 1:29241466-29241488 GTCCGGGTATCTGAGGGTGGGGG + Intronic
904513994 1:31039103-31039125 ACTCAGGCAGCTGAGGTGGGAGG - Intronic
904523485 1:31114091-31114113 ATTCAGGAAGCTGAGGTGGGAGG + Intergenic
904766170 1:32849251-32849273 CTCCAGGGGGCTGAGGTGGGAGG - Intronic
904792431 1:33033410-33033432 ATTCAGGAAGCTGAGGTGGGAGG + Intronic
905124549 1:35707847-35707869 CTCCCGGCAGCTGAGGTGGCGGG + Intergenic
905373749 1:37503545-37503567 GTTCAGGAAGCTGAGGTGGGAGG + Intronic
905673083 1:39805808-39805830 GCCCAGGAGGCTGAGGTGGGAGG - Intergenic
905744055 1:40398745-40398767 ATTCAGGAGGCTGAGGTTGGAGG - Intronic
905793947 1:40804878-40804900 ACTCAGGCAGCTGAGGTGGGAGG + Intronic
905857012 1:41320911-41320933 GAGCAGGCAGCTGGGGTGGGAGG - Intergenic
906043234 1:42805670-42805692 ACCCAGGAGGCTGAGGTTGGAGG + Intergenic
906330499 1:44880157-44880179 GCTCAGGAAGCTGAGGTGGGAGG - Intronic
907048302 1:51313383-51313405 GTCCAGGGAAGTGAGGTTGAGGG - Intronic
907178646 1:52550608-52550630 GTCCCAGAAGCTGAGGTAGGAGG - Intronic
907330805 1:53669868-53669890 ATTCAGGCAGCAGAGGGTGGGGG + Intronic
907588248 1:55640929-55640951 GAGAAGGCAGCTGAGGTTGGGGG + Intergenic
907801509 1:57770374-57770396 ATTCAGGAAGCTGAGGTGGGAGG - Intronic
908154474 1:61338290-61338312 GACCCGGCAGCTGAGCTTTGTGG - Intronic
908189706 1:61689476-61689498 GCTCAGGAGGCTGAGGTTGGAGG - Intronic
908714211 1:67053426-67053448 GTCCAGGCTGCGGAGGAGGGAGG + Intronic
909617025 1:77622196-77622218 ACTCAGGCAGCTGAGGTGGGAGG + Intronic
910172837 1:84396783-84396805 GTTCAGGAGGCTGAGGTGGGAGG - Intergenic
910194876 1:84630023-84630045 TCCCAGGAAGCTGAGGTGGGAGG + Exonic
910671770 1:89781012-89781034 GTTCAGGAGGCTGAGGTGGGAGG - Intronic
912144306 1:106773313-106773335 GTGCAGGCAGTTGAGGTGGCTGG - Intergenic
912558004 1:110530152-110530174 ATGCAGGCAGCAGAGGGTGGTGG + Intergenic
912999834 1:114568869-114568891 CTTCAGGAGGCTGAGGTTGGAGG - Intronic
913012866 1:114701664-114701686 TACCAGGAAGCTGAGGTGGGAGG + Intergenic
915117912 1:153612054-153612076 TTCCAGGCAAGTGAAGTTGGAGG + Intronic
915618577 1:157062952-157062974 GCTCAGGAAGCTGAGGTGGGAGG - Intergenic
916455074 1:164962731-164962753 GTCCAGGAAGGAGAGGGTGGTGG - Intergenic
916702195 1:167308632-167308654 GCTCAGGAAGCTGAGGTGGGAGG - Intronic
916774002 1:167940484-167940506 TTCCAGGAGGCTGAGGTGGGAGG - Intronic
917128491 1:171714661-171714683 GCTCAGGAAGCTGAGGTGGGAGG + Intronic
917167946 1:172134114-172134136 GTCCAGGCAAGAGAGGATGGTGG + Intronic
917283665 1:173402959-173402981 ACTCAGGCAGCTGAGGTTGGAGG - Intergenic
917543206 1:175935610-175935632 CTTCAGGAAGCTGAGGTGGGAGG - Intergenic
917846418 1:179024275-179024297 GCCCAGGAAGCTGAGGCTGCAGG + Intergenic
917934848 1:179856063-179856085 GTCCCAGCTGCTGAGGTGGGAGG + Intronic
918315810 1:183321925-183321947 ATTCAGGAAGCTGAGGTGGGAGG - Intronic
918656201 1:187028689-187028711 GTCTAGGCAGCAGAGGTTTGTGG - Intergenic
919248760 1:195025393-195025415 GTTCAGGATGCTGAGGTGGGAGG + Intergenic
919534749 1:198773759-198773781 ATTCAGGAAGCTGAGGTGGGAGG - Intergenic
919739501 1:200973471-200973493 GTCCAGGCTGCTGGGGTCGAGGG + Intronic
920077910 1:203350507-203350529 GTCCAGGGAGCTGTGGATTGGGG - Intronic
920093755 1:203472404-203472426 GGCCAGGCAGCAGAGGGAGGGGG - Intergenic
920355373 1:205368216-205368238 CTCCAGGAAGCTGAGGTGGGTGG + Intergenic
920886279 1:209931798-209931820 GTTCAGGAGGCTGAGGTGGGAGG - Intergenic
921681951 1:218044239-218044261 ATTCAGGAAGCTGAGGTGGGAGG + Intergenic
921791138 1:219292164-219292186 GTCCCGTCAGCTGAGATTTGAGG - Intergenic
922248966 1:223829223-223829245 ACCCAGGAAGCTGAGGTGGGAGG + Intronic
922280927 1:224123330-224123352 GCCCAGGAGGCTGAGGTGGGAGG + Intronic
922323182 1:224505188-224505210 GTCCAGGAGGCTGAGGTGGGAGG + Intronic
922333647 1:224600616-224600638 ATTCAGGAAGCTGAGGTCGGGGG - Intronic
922502416 1:226107137-226107159 GTTCAGGAGGCTGAGGTGGGTGG + Intergenic
922897572 1:229112309-229112331 GTCCCTGCAGATGTGGTTGGGGG - Intergenic
923300692 1:232637873-232637895 ATCCAGGAAACTAAGGTTGGAGG - Intergenic
923681014 1:236118789-236118811 GTCCTGGAAGCAGAGGTCGGGGG + Intergenic
923775426 1:236974189-236974211 GGCCAGCCACCTGAGGGTGGCGG + Intergenic
924535128 1:244929060-244929082 ACTCAGGCAGCTGAGGTGGGAGG - Intergenic
924698701 1:246427743-246427765 GCTCAGGAAGCTGAGGTGGGAGG + Intronic
1063088697 10:2842267-2842289 GCCCTGGCAGCTGTGGCTGGTGG + Intergenic
1063088712 10:2842356-2842378 GTCCAGGCAGGAGAGGCTGTGGG - Intergenic
1063166507 10:3468218-3468240 GTCCAGGGAGCCGGGGTTTGTGG + Intergenic
1063216897 10:3932867-3932889 GTCCAGGCCGCCGAGTTTGCTGG + Intergenic
1063373861 10:5540137-5540159 GGCCTGGGAGCTGAGGTGGGAGG - Intergenic
1063682789 10:8206047-8206069 GTTTAGGAAGCTGAGCTTGGAGG + Intergenic
1064473590 10:15662445-15662467 GTTCAGGAAGCTGAGGTAGAAGG - Intronic
1064784339 10:18877431-18877453 ACTCAGGCAGCTGAGGTGGGAGG - Intergenic
1064885786 10:20110682-20110704 CTCCCGGCAGCTGACCTTGGAGG + Intronic
1064970184 10:21057656-21057678 GTTCAGGAAGCTGAGGTGGGAGG - Intronic
1065013466 10:21440553-21440575 GTCTAGGAGGCTGAGGTAGGAGG + Intergenic
1065048151 10:21762716-21762738 GCCCAGGAGGCTGAGGTGGGAGG - Intronic
1065322355 10:24521396-24521418 ATCCAGGAAGCTGAGGCAGGAGG + Intronic
1065636851 10:27742954-27742976 GTCCAGGCAGCGGAGGGCCGAGG + Intronic
1066120597 10:32282409-32282431 ACCCAGGAGGCTGAGGTTGGGGG + Intronic
1066602255 10:37122241-37122263 CTCCGGGAAGCTGAGGTGGGTGG - Intergenic
1067759440 10:49032649-49032671 GGCCAGGCAGATGGGGGTGGGGG - Intronic
1068381689 10:56262075-56262097 ATCCAGGAAGATGAGGTGGGAGG + Intergenic
1069457965 10:68568740-68568762 ATTCGGGCAGCTGAGGTGGGAGG + Intronic
1069537167 10:69263171-69263193 GTGGTGGCAGCTGAGGTGGGAGG - Intronic
1069557449 10:69407450-69407472 GCACAGGCCTCTGAGGTTGGGGG - Intronic
1069672962 10:70225324-70225346 GTCCAGGAGGCAGAGGTAGGAGG - Intronic
1069796284 10:71053747-71053769 GGCCAGGTGACTGAGGTTGGGGG - Intergenic
1069999357 10:72364844-72364866 GTCCCAGCGGCTGAGGTGGGAGG - Intergenic
1070915253 10:80149958-80149980 GCCCAGGAGGCTGAGGTGGGAGG - Intergenic
1070965243 10:80526400-80526422 TTCCTGGAAGCTGTGGTTGGTGG + Exonic
1071089695 10:81904084-81904106 ACCCAGGCAGCAGAGGTTGCAGG - Intronic
1071589120 10:86855011-86855033 ACCCAAGCAGCTGAGGTTGCAGG - Intronic
1071876836 10:89851699-89851721 TTCCAGGCAGCACAGGTGGGTGG - Intergenic
1072113439 10:92345801-92345823 GTGCAGGAGGCTGAGGTGGGAGG - Intronic
1072587118 10:96792450-96792472 CTTCAGGAAGCTGAGGTGGGAGG - Intergenic
1072609163 10:97005041-97005063 GTCCAGGCAGGGGAGGGTGATGG + Intronic
1072664518 10:97384106-97384128 GTCCTGGCTGCTGAGGTTGGGGG - Intronic
1072664529 10:97384143-97384165 GGCCTGGCTGCTGAGGTTGGGGG - Intronic
1072664577 10:97384327-97384349 CTCCAGGCTGCAGAGGTTGGGGG - Intronic
1072664591 10:97384364-97384386 GTCCAGGCTGCCAAGGTGGGGGG - Intronic
1072664615 10:97384440-97384462 GTCCAGGCTGCCGAAGTTGGGGG - Intronic
1072664642 10:97384553-97384575 GTCCAGGCAGCTGAGGTTGGGGG - Intronic
1072664654 10:97384590-97384612 GTCCTGGCTGCCGAGGTTGGGGG - Intronic
1072664666 10:97384627-97384649 GTCCAGGCTGCCGAGATTGGGGG - Intronic
1072664690 10:97384739-97384761 ATCCTGGCTGCCGAGGTTGGGGG - Intronic
1072664702 10:97384776-97384798 GTCCAGGCTGCCGAGATTGGGGG - Intronic
1072664727 10:97384886-97384908 GTCCAGGCTGCCAAGATTGGGGG - Intronic
1072664750 10:97384962-97384984 GTCCAGGCTGCTGAGGTGGGGGG - Intronic
1072664789 10:97385075-97385097 GTCCAGGCTGCCGAGGTGGGGGG - Intronic
1072966786 10:99980694-99980716 ATTCAGGAAGCTGAGGTGGGAGG + Intronic
1073052111 10:100674089-100674111 ATTCAGGAAGCTGAGGTGGGAGG - Intergenic
1073180311 10:101579364-101579386 GTTCAGCCAGCTGAGGCTGGAGG + Exonic
1073540734 10:104314822-104314844 CTGCAGGCAGCTGAGGTGGCAGG + Exonic
1074107541 10:110399767-110399789 GTCCAGGGAGGTGAGGCAGGAGG + Intergenic
1074493302 10:113957852-113957874 GTCCAGGCAGCATTGGATGGGGG - Intergenic
1074590954 10:114812635-114812657 CTTTAGGCAGCTGAGGTGGGAGG + Intergenic
1076151977 10:128169778-128169800 GTAGAGGCAGCTGTGTTTGGTGG - Intergenic
1076482736 10:130795544-130795566 GTCCAGGCTACTGAGGAGGGAGG - Intergenic
1076606255 10:131691708-131691730 GTCCCGGGAGCAGGGGTTGGGGG - Intergenic
1076625940 10:131822125-131822147 TTCCAGGCAGCAGAGGGTGCAGG + Intergenic
1076653030 10:132003211-132003233 GTTCAGGAAGCTGAGGCAGGAGG + Intergenic
1076873332 10:133204144-133204166 GTCCTGGCTTCTGAGGATGGTGG - Intronic
1077315500 11:1917751-1917773 GCCCAGCCAGCTGAGGTCAGAGG - Intergenic
1077503365 11:2919223-2919245 GGCCAGGCTGCTGAGGCGGGAGG + Intronic
1077893184 11:6434436-6434458 GTTCAGGAGGCTGAGGTGGGAGG - Intronic
1078291257 11:10012252-10012274 ATGCAGGAAGCTGAGGTAGGAGG - Intronic
1079001530 11:16761555-16761577 ATTCAGGAAGCTGAGGTGGGAGG + Intergenic
1079496521 11:21050919-21050941 GTCCTAGCTGCTGAGGTTGATGG + Intronic
1080571075 11:33557776-33557798 ATCCAGGAGGCTGAGGTGGGAGG + Intronic
1080660288 11:34290596-34290618 CTTCAGGAAGCTGAGGTGGGAGG + Intronic
1080825998 11:35849890-35849912 ATCCAGGAGGCTGAGGTGGGAGG + Intergenic
1081581487 11:44355330-44355352 GCCCAGGAGGCTGAGGTGGGAGG - Intergenic
1082131762 11:48498513-48498535 GCTCAGGAGGCTGAGGTTGGAGG + Intergenic
1082245320 11:49915042-49915064 GCTCAGGAGGCTGAGGTTGGAGG - Intergenic
1082800286 11:57409415-57409437 GGCCAGACAGGTGTGGTTGGAGG - Intronic
1082904708 11:58293128-58293150 CTCCAGGAGGCTGAGGCTGGAGG - Intergenic
1083230882 11:61317982-61318004 GTTCAGGAGGCTGAGGTGGGAGG - Intronic
1083469345 11:62872404-62872426 GTTCAGGAGGCTGAGGTGGGAGG + Intronic
1083935283 11:65866802-65866824 GTCCTGGTGGCTGAGGTGGGCGG - Exonic
1084060146 11:66667006-66667028 ATTCAGGAAGCTGAGGCTGGAGG - Intronic
1084308682 11:68303020-68303042 GCGGAGGCAGCTGAGGTGGGAGG + Intergenic
1084900535 11:72306815-72306837 CTCCAAGGAGCTCAGGTTGGAGG - Intronic
1084946174 11:72639779-72639801 GTAGGGGCAGCTGGGGTTGGGGG + Intronic
1085131671 11:74044612-74044634 GTGCAGGATGCTGAGGTTTGGGG + Intronic
1085198852 11:74689253-74689275 ATTCAGGAAGCTGAGGTAGGAGG - Intergenic
1085478881 11:76805672-76805694 GGCATGGCAGCTGAGGTAGGAGG - Intergenic
1085978639 11:81694018-81694040 GTGAAGGCAGCTGAGGGCGGGGG - Intergenic
1086478161 11:87202432-87202454 GTTCAGGAGGCTGAGGTGGGAGG - Intronic
1086597624 11:88592920-88592942 ATTCAGGAAGCTGAGGTGGGAGG - Intronic
1087013380 11:93533780-93533802 GTCGGGGCAGATGAGGGTGGGGG - Intronic
1087026027 11:93650649-93650671 GTCAAGGAAGATGAAGTTGGAGG + Intergenic
1087097024 11:94328881-94328903 ATGCAGGCAGCAGAGGCTGGAGG + Intergenic
1088478863 11:110273101-110273123 TTCCAGGAAGCTGAGATGGGAGG + Intronic
1089540788 11:119188055-119188077 GTGCAGGCAGCGGGGCTTGGTGG - Exonic
1089579576 11:119473064-119473086 CTCCAGGAAGATGTGGTTGGCGG + Intergenic
1090637616 11:128700763-128700785 GCTCAGGGAGCTGAGGTGGGAGG + Intronic
1090646321 11:128769208-128769230 GTGCAGGCAGCTGAGCTTGCTGG - Intronic
1091412628 12:254132-254154 CTCCTGGCAGCTGAGGGTGGAGG + Intronic
1092153708 12:6268602-6268624 GGCCAGTCAGCTGAGGTCAGAGG + Intergenic
1092190947 12:6520348-6520370 CTCGAGGGAGCTGAGGTGGGAGG - Intronic
1092547328 12:9463355-9463377 CTTCAGGAAGCTGAGGTAGGAGG - Intergenic
1092658170 12:10709811-10709833 TTTCTGGCAGCTGATGTTGGAGG + Intronic
1093247628 12:16759773-16759795 ACCCAGGAGGCTGAGGTTGGAGG - Intergenic
1093699727 12:22205672-22205694 CTTTAGGCAGCTGAGGTGGGAGG + Intronic
1094622581 12:32094315-32094337 ATCCAGGAGGCTGAGGTAGGAGG - Intergenic
1094761566 12:33539359-33539381 GTCCAGGAGGCTGAGGTGGGAGG - Intergenic
1095871209 12:47030178-47030200 GCTCAGGAAGCTGAGGTAGGAGG + Intergenic
1096159428 12:49364809-49364831 GCCCAGGAGGCTGAGGTAGGAGG - Intergenic
1096680319 12:53251692-53251714 GTCCAGACACCTGAGGGAGGCGG - Exonic
1096740506 12:53690460-53690482 ATTTAGGCAGCTGAGGCTGGTGG - Intergenic
1096843641 12:54393410-54393432 TTGCAGGCAGCTGGGGTGGGGGG + Intergenic
1097294906 12:57951646-57951668 TTCCAGGCAGGTGAGCTTGTGGG + Intronic
1097299927 12:58007254-58007276 ACTCAGGAAGCTGAGGTTGGAGG - Intergenic
1097420493 12:59372751-59372773 GTTCAGGAGGCTGAGGTGGGTGG - Intergenic
1097797436 12:63879111-63879133 GTTCAGGAGGCTGAGGTGGGAGG - Intronic
1098150606 12:67542695-67542717 GGCCCAGAAGCTGAGGTTGGCGG - Intergenic
1098228614 12:68350323-68350345 TCCCAGGCAGCTGAGCTAGGAGG - Intergenic
1098781374 12:74691050-74691072 GTTGAGGCTGCTGAGGTTGGGGG + Intergenic
1099674908 12:85746388-85746410 GTTCAGGAGGCTGAGGTGGGAGG - Intergenic
1100495844 12:95123988-95124010 GTCCAGGAGGTCGAGGTTGGTGG - Intronic
1100533360 12:95481300-95481322 ATTCAGGAAGCTGAGGTGGGAGG + Intronic
1100630837 12:96387832-96387854 GCTCAGGAAGCTGAGGTGGGAGG + Intronic
1100695879 12:97092534-97092556 ACTCAGGCAGCTGAGGTAGGAGG - Intergenic
1101718894 12:107334278-107334300 GCCCAGGCAGGAGAGGATGGTGG + Intronic
1101764790 12:107687655-107687677 ATTCAGGAAGCTGAGGTGGGAGG + Intronic
1102147933 12:110668909-110668931 GTACAGGAAGCTGAGGAGGGTGG - Intronic
1102324892 12:111971965-111971987 CTTAAGGAAGCTGAGGTTGGAGG + Intronic
1102399018 12:112612639-112612661 GCCCAGGAAGTTGAGGTTGCAGG - Intronic
1102433039 12:112898453-112898475 GTGCAGGGAGCTGAGGGTGGAGG - Exonic
1102841196 12:116125225-116125247 ATTCAGGCTGCTGAGGTGGGAGG + Intronic
1102902669 12:116650541-116650563 CTTCCGGCAGCTGAGGTGGGAGG + Intergenic
1102905017 12:116667761-116667783 TCCCAGGAAGCTGAGGTGGGAGG + Intergenic
1103171589 12:118825149-118825171 GTTCAGGAAGCTGAGGTGGGAGG - Intergenic
1103242541 12:119426462-119426484 GCTCAGGAAGCTGAGGTAGGAGG - Intronic
1103251955 12:119507722-119507744 GGCCAGGAAGCTGAGGTGGGAGG - Intronic
1103446636 12:120999346-120999368 GGCCAGGGCGCTCAGGTTGGTGG - Exonic
1103959889 12:124602909-124602931 CTCCAGGAAGCTGACGTTAGAGG + Intergenic
1104323408 12:127773251-127773273 ATGCAGGGAGCTGAGGTGGGAGG + Intergenic
1104356451 12:128090863-128090885 GGTCAGGCGGCTGAGGTAGGAGG - Intergenic
1104443350 12:128813297-128813319 GTACAGGAGGCTGAGGTGGGAGG - Intronic
1104879287 12:132058893-132058915 ATTCAGGAAGCTGAGGTGGGAGG - Intronic
1104925440 12:132311655-132311677 GTCCTGGGATCTGAGGGTGGAGG - Intronic
1105234092 13:18530531-18530553 ATCCAGGAAGCTGAGGTGGGAGG - Intergenic
1105618918 13:22048120-22048142 GTTCAGGAAGCTGAGGTGAGAGG + Intergenic
1105805205 13:23948351-23948373 TTCCAGGATGCTCAGGTTGGGGG + Intergenic
1106517711 13:30469574-30469596 TCCCAGGAAGCTGAGGTGGGAGG - Intronic
1106673474 13:31932387-31932409 GCCCAGGAGGCTGAGGTAGGAGG - Intergenic
1107869554 13:44734567-44734589 AGCCAGGCAGCTGTGGTTTGGGG - Intergenic
1107998164 13:45882068-45882090 GTCCAGACTGATGAGGGTGGGGG - Intergenic
1108091357 13:46853319-46853341 GCCCAGGCAGATGAGTATGGAGG - Intronic
1108713499 13:53056961-53056983 GCCCAGGAGGCTGAGGTGGGAGG - Intergenic
1108776349 13:53769555-53769577 GTGCAAGAAGTTGAGGTTGGAGG + Intergenic
1109685197 13:65810778-65810800 GTCCATGATGCTGAGGTTTGGGG + Intergenic
1109854508 13:68109334-68109356 ATCCAGGAGGCTGAGGTGGGAGG - Intergenic
1111516876 13:89345040-89345062 ATACAGGAAGCTGAGGTGGGAGG + Intergenic
1111682018 13:91454866-91454888 GCTCAGGAGGCTGAGGTTGGAGG - Intronic
1112076795 13:95922712-95922734 GCCCAGGAGGCTGAGGTGGGAGG + Intronic
1112148618 13:96730840-96730862 CTACAGGAAGCTGAGGTGGGAGG - Intronic
1112306699 13:98280694-98280716 GTCCAGGCAGTTGAGTTTTCTGG - Intronic
1112330038 13:98470218-98470240 ATCCAGGAGGCTGAGGTGGGAGG - Intronic
1114318938 14:21530716-21530738 ATTCAGGAAGCTGAGGTGGGAGG - Intronic
1114560950 14:23589930-23589952 GTCCAGGGAGCAGAGGATGAGGG + Intergenic
1115252466 14:31363869-31363891 ACCCAGGAGGCTGAGGTTGGAGG + Intronic
1115362881 14:32523575-32523597 ATTCAGGAAGCTGAGGTGGGAGG - Intronic
1115635359 14:35285707-35285729 CTTCAGGGAGCTGAGGGTGGGGG + Intronic
1115699361 14:35935400-35935422 GCCCAGGAGGCTGAGGTGGGAGG - Intergenic
1116852518 14:49922603-49922625 GTCCAGGAGGCTGAGGTGGCAGG + Intergenic
1117114194 14:52492873-52492895 TTCAAGGCAGTTGGGGTTGGGGG - Intronic
1117432953 14:55687624-55687646 AGCCAGACAGCTTAGGTTGGAGG - Intronic
1118246339 14:64114724-64114746 ACCCAGGAAGCTGAGGTGGGAGG - Intronic
1118262676 14:64262221-64262243 ATCCAGGAGGCTGAGGTGGGAGG - Intronic
1118284876 14:64462175-64462197 GTCCAGGCTGCTGAGGCAGGAGG + Intronic
1118837285 14:69485855-69485877 GACCAGGCAGCTGGGGCTGAAGG - Intronic
1119552163 14:75522822-75522844 GCCCAGGGAGCTGAGGATGGAGG + Intronic
1119563160 14:75606833-75606855 ACCCAGGAGGCTGAGGTTGGGGG + Intronic
1119677053 14:76563621-76563643 ATCCAGGCAGCTGGGCGTGGTGG - Intergenic
1120969162 14:90192956-90192978 GCCCAGGAGGCTGAGGTGGGAGG + Intergenic
1121004766 14:90483077-90483099 CTGCAGGGAGCTGAGGCTGGAGG + Intergenic
1121094878 14:91210159-91210181 GTTCAGGAGGCTGAGGTGGGAGG + Intronic
1121278642 14:92685054-92685076 GACCCGGCAGCTGAGTGTGGAGG + Exonic
1121451483 14:94011098-94011120 GTCCAGGCAGGGGTAGTTGGTGG - Intergenic
1121700356 14:95949099-95949121 GCTCAGGCGGCTGAGGTGGGAGG - Intergenic
1121815663 14:96926176-96926198 GCTCAGGAAGCTGAGGTGGGAGG + Intronic
1122029070 14:98899516-98899538 ATCCACGCTGCTGGGGTTGGGGG - Intergenic
1122405179 14:101496553-101496575 CTCCCTGCAGATGAGGTTGGGGG + Intergenic
1122519606 14:102334115-102334137 CTCCAGGCAGCTGTGGAGGGAGG - Intronic
1122564358 14:102641489-102641511 ATTCAGGAAGCTGAGGTGGGCGG + Intronic
1122753675 14:103959339-103959361 ATTCAGGAAGCTGAGGCTGGAGG - Intronic
1122865555 14:104602447-104602469 GTCTGGGAAGCTGAGGGTGGAGG - Intronic
1122882489 14:104696414-104696436 CTCAAGGCAGGTGAGGATGGGGG - Intronic
1123430591 15:20212301-20212323 GTCCTTGGAGCTGAGGTGGGAGG - Intergenic
1123433420 15:20237382-20237404 GTCCAGGCTGGTGACGTTAGTGG - Intergenic
1124372369 15:29110983-29111005 GGCCAGGAAGCTGAGGGTGGTGG + Intronic
1125384313 15:39121212-39121234 GTGCAGGATGCTGAGGTTCGGGG - Intergenic
1125482802 15:40092226-40092248 GTTCATGCAGCTGAGGTTTGAGG - Intronic
1125510458 15:40289840-40289862 GTCCATGCAGCTGGGGTGGCAGG - Intronic
1125923590 15:43542398-43542420 ACTCAGGAAGCTGAGGTTGGAGG - Intronic
1126155583 15:45562801-45562823 CTCCAGGAGGCTGAGGTGGGAGG + Intergenic
1126763377 15:51989845-51989867 ATTCAGGAAGCTGAGGTGGGAGG - Intronic
1127199443 15:56627643-56627665 ATCCAGGAGGCTGAGGTGGGAGG - Intergenic
1127274021 15:57426553-57426575 ATTCAGGAAGCTGAGGTGGGAGG - Intronic
1127421715 15:58812747-58812769 ATTCAGGAAGCTGAGGTGGGAGG + Intronic
1127655839 15:61054943-61054965 ATTCAGGAAGCTGAGGTGGGAGG - Intronic
1127993577 15:64138172-64138194 GAACAGGTAGCTGAGGTAGGCGG - Exonic
1128059467 15:64725604-64725626 ATTCAGGCAGTTGAGGTGGGAGG + Intergenic
1128307291 15:66607749-66607771 GTACAGGGGGCTGAGGTGGGAGG - Intronic
1128587376 15:68861451-68861473 ACCCAGGAGGCTGAGGTTGGTGG - Intronic
1129294214 15:74591080-74591102 GACCACCCAGTTGAGGTTGGTGG - Intronic
1129383636 15:75183732-75183754 ATTCAGGAGGCTGAGGTTGGAGG - Intergenic
1129430002 15:75493044-75493066 ATTCAGGAAGCTGAGGTAGGAGG + Intronic
1129602905 15:77010556-77010578 TTCCAGGCAGCTGAGTCTGAGGG + Intronic
1129887590 15:79049361-79049383 GTCTTTGGAGCTGAGGTTGGGGG + Intronic
1130075762 15:80688507-80688529 GTCCGGGAAGCAGAGGTTGCAGG - Intronic
1130145551 15:81271362-81271384 GCCCAGGAGGCTGAGGTGGGAGG + Intronic
1130890824 15:88132559-88132581 TTCCAGGCAGCTAAGCATGGAGG - Intronic
1131178876 15:90227154-90227176 GCTCAGGAGGCTGAGGTTGGAGG - Intronic
1131931541 15:97448525-97448547 GTCCAGGTGGCTGAGGGTGGCGG + Intergenic
1132350457 15:101136646-101136668 GTCCTGGAAGCGGAGGGTGGGGG - Intergenic
1132392275 15:101447708-101447730 GTCCAGGCTGCTGAGCAGGGAGG - Intronic
1132504894 16:302968-302990 ATTCAGGAAGCTGAGGTGGGAGG - Intronic
1132538299 16:494792-494814 GTCGAGGCTGCAGAGGTGGGAGG + Intronic
1132538308 16:494833-494855 GTCGAGGCTGCAGAGGTGGGAGG + Intronic
1132538318 16:494874-494896 GTCGAGGCTGCAGAGGTGGGAGG + Intronic
1132538328 16:494915-494937 GTCGAGGCTGCTGAGGTGGGAGG + Intronic
1132538338 16:494956-494978 GTCGAGGCTGCTGAGGTGGGAGG + Intronic
1132538348 16:494997-495019 GTCGAGGCTGCAGAGGTGGGAGG + Intronic
1132697124 16:1206988-1207010 GCCCAGGATGCTGAGGGTGGGGG - Exonic
1132729357 16:1353630-1353652 ACTCAGGAAGCTGAGGTTGGTGG - Intronic
1132843494 16:1989822-1989844 GGGCAGGCAGGTGAGGGTGGGGG + Intronic
1132905524 16:2280721-2280743 GTCCAGGCAGCTCAGGTGTGGGG - Intronic
1133026371 16:2990578-2990600 GCCCAGCCAGGTGAGGCTGGGGG + Intergenic
1133115006 16:3573317-3573339 CTCAAGGAAGCTGAGGTGGGAGG + Intronic
1133400643 16:5484060-5484082 ACTCAGGAAGCTGAGGTTGGAGG + Intergenic
1134128200 16:11630685-11630707 ATCTAGGAAGCTGAGGTGGGAGG - Intronic
1134394919 16:13853921-13853943 ACCCAGGAAGCTGAGGCTGGAGG + Intergenic
1135117534 16:19736369-19736391 GCTCAGGAAGCTGAGGTGGGAGG - Intronic
1135568022 16:23527069-23527091 GCTCAGGCAGCTGAGGTGGGAGG - Intronic
1135798839 16:25473739-25473761 CTCAAGGGAGCTGAGATTGGTGG + Intergenic
1136414567 16:30095685-30095707 GACCTGGCAGCTGAAGCTGGAGG + Exonic
1136851205 16:33613746-33613768 GTCCAGGCTGGTGAAGTTAGTGG + Intergenic
1136854046 16:33638916-33638938 GTCCTTGGAGCTGAGGTGGGAGG + Intergenic
1138041281 16:53670986-53671008 GCTCAGGCTGCTGAGGTGGGAGG + Intronic
1138575316 16:57903922-57903944 GTCCATGCAGCTGCGGTAGTAGG + Exonic
1138741215 16:59312863-59312885 GTCCAGTTTGCTGAGGATGGTGG + Intergenic
1138754736 16:59469733-59469755 GTTCAGGGCGCTGAGGTGGGAGG - Intergenic
1139348029 16:66317082-66317104 GGCAAGGCTGGTGAGGTTGGAGG - Intergenic
1139492463 16:67293702-67293724 TTCCAGGCAGCTGAGGTGCTGGG + Exonic
1139544062 16:67640852-67640874 ATCCAGGAGGCTGAGGTAGGAGG - Intergenic
1139582927 16:67883943-67883965 TTCCAGGTAGCTGGGGATGGGGG - Exonic
1139727757 16:68915373-68915395 ACCCAGGAAGCTGAGGTGGGAGG - Intronic
1140027439 16:71303449-71303471 GTCCAGTCAGCTGTGGCTGGGGG - Intergenic
1140041026 16:71408196-71408218 ATGCAGGAAGCTGAGGTGGGAGG - Intergenic
1140098823 16:71896857-71896879 GTCCAGGAGGCTGAGGTAGGAGG + Intronic
1140604912 16:76523820-76523842 GTTCAAGAAGCTGAGGTGGGAGG + Intronic
1140832750 16:78766477-78766499 ATTCAGGCAGCTGAGGCAGGAGG + Intronic
1141041584 16:80677077-80677099 TTCCAGGGAGCTGAGGTGGGAGG - Intronic
1141603602 16:85140708-85140730 ATCCAGGAGGCTGAGGTGGGAGG - Intergenic
1141616012 16:85209775-85209797 ATCCAGGCAGCTGAGGCTGAGGG + Intergenic
1203112810 16_KI270728v1_random:1462207-1462229 GTCCAGGCTGGTGAAGTTAGTGG + Intergenic
1143189131 17:5028913-5028935 GCTCAGGAAGCTGAGGTGGGAGG - Intergenic
1143502519 17:7347504-7347526 GTCAAGGCTGCTGAGGGTGGGGG + Intronic
1143622087 17:8086492-8086514 CTCCAGGCACCTGAGGTTGCAGG + Intronic
1143663331 17:8340804-8340826 ATCCAGGAGGCTGAGGTGGGAGG + Intronic
1144344754 17:14339789-14339811 GGACAGGCTGCTGAGGTTGCTGG + Intronic
1144392521 17:14807993-14808015 ACTCAGGCAGCTGAGGTGGGAGG + Intergenic
1145797802 17:27666097-27666119 GCCCACCCAGCTGAGGATGGGGG + Intergenic
1146119018 17:30173205-30173227 CTTCAGGAGGCTGAGGTTGGCGG - Intronic
1146272812 17:31495481-31495503 ACTCAGGCAGCTGAGGTGGGAGG - Intronic
1146586898 17:34090466-34090488 GTACAGGGGGCTGGGGTTGGGGG + Intronic
1146842282 17:36164322-36164344 GCCCACCCAGCTGAGGATGGGGG + Intergenic
1146854592 17:36252281-36252303 GCCCACCCAGCTGAGGATGGGGG + Intronic
1146866028 17:36336095-36336117 GCCCACCCAGCTGAGGATGGGGG - Intronic
1146870492 17:36376173-36376195 GCCCACCCAGCTGAGGATGGGGG + Intronic
1146877850 17:36427254-36427276 GCCCACCCAGCTGAGGATGGGGG + Intronic
1147068897 17:37936707-37936729 GCCCACCCAGCTGAGGATGGGGG - Intergenic
1147073375 17:37976797-37976819 GCCCACCCAGCTGAGGATGGGGG + Intergenic
1147080421 17:38016244-38016266 GCCCACCCAGCTGAGGATGGGGG - Intronic
1147084897 17:38056335-38056357 GCCCACCCAGCTGAGGATGGGGG + Intronic
1147096368 17:38140204-38140226 GCCCACCCAGCTGAGGATGGGGG - Intergenic
1147100844 17:38180301-38180323 GCCCACCCAGCTGAGGATGGGGG + Intergenic
1147174674 17:38647277-38647299 ACTCAGGCAGCTGAGGTGGGAGG + Intergenic
1147585623 17:41652673-41652695 CTCCAGGCAGCTGGGTTGGGGGG - Intergenic
1147616537 17:41831977-41831999 GCCCAGGCAGTTGAGGCTGCAGG + Intronic
1148128396 17:45248279-45248301 GCCCAGGCTGCGGGGGTTGGGGG - Intergenic
1148377107 17:47158725-47158747 GTTCAGGAGGCTGAGGTAGGAGG - Intronic
1148411084 17:47467749-47467771 GCCCAGGAGGCTGAGGTGGGAGG + Intergenic
1148645525 17:49217872-49217894 GTCCAGGCAGCCAAAGTTGAGGG - Exonic
1148659736 17:49319748-49319770 GTTCAGGAGGCTGAGGTGGGAGG - Intronic
1148711750 17:49686846-49686868 GTCCAGGCAAAAGAGGATGGTGG - Intergenic
1148820083 17:50355102-50355124 GTCTGGGCACCTGGGGTTGGAGG + Intronic
1149230908 17:54532923-54532945 TTTCAGGAAGCTGAGGTGGGAGG - Intergenic
1149626155 17:58082600-58082622 GTCCAGGTAGACAAGGTTGGAGG - Intergenic
1149845437 17:60006765-60006787 GCCCACCCAGCTGAGGATGGGGG + Intergenic
1149920495 17:60654393-60654415 TCCCAAGCAGCTGAGGTGGGAGG + Intronic
1150008146 17:61482433-61482455 TTCCTGGGAGCTGAGGATGGAGG + Intronic
1150083785 17:62263348-62263370 GCCCACCCAGCTGAGGATGGGGG + Intergenic
1150290894 17:63981139-63981161 AACCAGGAAGCTGAGGTGGGAGG + Intergenic
1150475921 17:65474877-65474899 GTCCAATCAGCTGAGGTGGAAGG + Intergenic
1150535176 17:66031565-66031587 GCTCAGGAAGCTGAGGTGGGAGG - Intronic
1150712407 17:67543223-67543245 CTGCAGGCAGCAGAGGTAGGGGG - Intronic
1150770404 17:68035990-68036012 GACCAGGCGGCTGAGTTTCGCGG + Exonic
1150907807 17:69356800-69356822 ATTCAGGAGGCTGAGGTTGGGGG + Intergenic
1151363704 17:73603982-73604004 CTCCTGCCAGCTGACGTTGGTGG - Intronic
1151706699 17:75772976-75772998 ATCCAGCCAGCTGTGCTTGGGGG + Intergenic
1151722765 17:75867390-75867412 GTTCAGGAGGCTGAGGTGGGAGG - Intergenic
1151961223 17:77406910-77406932 GTCAGGGAAGCTGAGGTGGGTGG - Intronic
1152288291 17:79424782-79424804 GTCCAGGCAGGCCAGGTTTGAGG - Intronic
1152639838 17:81444840-81444862 GTCCAGGCTGCTGTACTTGGGGG + Intronic
1152641410 17:81450798-81450820 ACCCAGGAAGCTGAGGTGGGAGG + Intronic
1152832960 17:82510059-82510081 ATTCAGGAAGCTGAGGTAGGAGG + Intergenic
1153011366 18:542590-542612 GCCCCGGCACCTGAGTTTGGTGG - Intergenic
1153225154 18:2894225-2894247 GTCCTGGCAGCTCAGGAGGGTGG + Intronic
1153758481 18:8307124-8307146 GTCCAAGCAGCAGAGCATGGGGG + Intronic
1154166326 18:12017282-12017304 CTCCAGGCAGCTGGGGGTGGCGG - Intronic
1154515446 18:15159351-15159373 ATCCAGGAAGCTGAGGTGGGAGG + Intergenic
1154988968 18:21581977-21581999 ATTCAGGAAGCTGAGGTGGGTGG + Intronic
1156325309 18:36069323-36069345 TCCCAGGAAGCTGAGGTAGGAGG + Intergenic
1156642423 18:39118537-39118559 GTTCAGGAGGCTGAGGCTGGAGG + Intergenic
1156833570 18:41525347-41525369 GTCCAGTGACCTCAGGTTGGTGG - Intergenic
1157403653 18:47406138-47406160 GTCCAGGTAGCAAAGGTTGGAGG - Intergenic
1157568958 18:48699459-48699481 GTGGAGGAAGCTGAGGTTGCAGG + Intronic
1157801303 18:50623580-50623602 GTCCAGGCAGGTGATGATGGTGG - Intronic
1157997196 18:52572548-52572570 GTCCAGGCACCTGCAGTTGAGGG + Intronic
1158120425 18:54042682-54042704 GTTCAAGCAGCTGAGCATGGGGG + Intergenic
1158419791 18:57283007-57283029 ATTCAGGAAGCTGAGGTGGGAGG + Intergenic
1158595294 18:58810555-58810577 GCTCAGGAAGCTGAGGTAGGAGG + Intergenic
1158643066 18:59219837-59219859 CTCAAGGCAGCTAAGGCTGGAGG + Intergenic
1158650198 18:59277357-59277379 TTGCAGGAAGCTGAGGTGGGAGG - Intronic
1159582984 18:70253669-70253691 GTCCAGGGTGCTGAGGGTGAAGG - Intergenic
1159586189 18:70285975-70285997 GTTCAGGAGGCTGAGGCTGGAGG - Intergenic
1159664486 18:71141585-71141607 CTCCAGGAAGATGAGGCTGGAGG + Intergenic
1160130079 18:76217851-76217873 CTTCAGGAAGCTGAGGTGGGTGG + Intergenic
1160277157 18:77447817-77447839 GTCCAGGCAGCTGAGGGAGGTGG + Intergenic
1160469776 18:79118960-79118982 ACTCAGGAAGCTGAGGTTGGAGG + Intronic
1160611385 18:80089590-80089612 ATTCAGGAAGCTGAGGTGGGTGG - Intronic
1160699079 19:497601-497623 CTCCAGGCAGCTGGGGTTCGGGG + Intronic
1160876031 19:1296554-1296576 GTGCAGGGGGCTGAGGTGGGAGG + Intronic
1161125825 19:2556617-2556639 GCCAAGGAAGCTGAGGTCGGCGG + Intronic
1161366496 19:3882750-3882772 GTTCAGGAGGCTGAGGTGGGAGG - Intronic
1161469116 19:4447616-4447638 GTCCAGGTACCTGGGGTAGGTGG + Exonic
1161600394 19:5178958-5178980 GCTCAGGAAGCTGAGGTGGGAGG - Intronic
1161643755 19:5439967-5439989 ATTCAGGAAGCTGAGGTGGGAGG + Intergenic
1161723710 19:5916897-5916919 GTTCTGGCCTCTGAGGTTGGGGG - Exonic
1162016195 19:7847821-7847843 CTCCAGGTGGCTCAGGTTGGAGG - Exonic
1162153029 19:8658839-8658861 GTTCAGGAGGCTGAGGTGGGAGG + Intergenic
1162276650 19:9661256-9661278 ATTCAGGAAGCTGAGGTGGGAGG - Intronic
1162317259 19:9947115-9947137 ATCCAGGAGGCGGAGGTTGGTGG + Intergenic
1162397906 19:10428247-10428269 GCTCAGGAAGCTGAGGTTGAAGG + Intronic
1162463065 19:10824693-10824715 CTCCAGGGCGCTGAGGTGGGAGG + Intronic
1162483254 19:10941996-10942018 GCTCAGGAGGCTGAGGTTGGAGG - Intergenic
1162582274 19:11538722-11538744 GGGAAGGCAGCTGAGGTTGTGGG + Exonic
1162669809 19:12246780-12246802 GCTCAGGAAGCTGAGGTGGGAGG + Intronic
1162909059 19:13839859-13839881 GGCCGGGCAGCCCAGGTTGGCGG - Intergenic
1163308548 19:16497996-16498018 ACCCAGGAAGCTGAGGTGGGAGG + Intronic
1163337714 19:16684228-16684250 ATTCAGGAAGCTGAGGTAGGGGG + Intronic
1163417180 19:17193767-17193789 ATTCAGGAAGCTGAGGTGGGAGG + Intronic
1163531461 19:17851760-17851782 GTCCAGGAGGCAGAGGTTGCAGG + Intergenic
1164018454 19:21274229-21274251 ATTCAGGAAGCTGAGGTAGGAGG + Intronic
1165384055 19:35500198-35500220 GTAAAGGCAGGTGAGGGTGGGGG - Intronic
1166122331 19:40693132-40693154 GCCCAGGCAGATGAGAATGGAGG - Intronic
1166387521 19:42390451-42390473 GTCCTGGGAGCTGAGGCAGGAGG - Intergenic
1166558660 19:43717958-43717980 GTTCAGGAGGCTGAGGTGGGAGG + Intronic
1166594658 19:44034835-44034857 GCCCAGGAACCTGTGGTTGGTGG - Intergenic
1166630706 19:44404515-44404537 GCTCAAGCAGCTGAGGTGGGAGG + Intergenic
1166683019 19:44779459-44779481 GACCAGGCAGATGAGGTTTGGGG + Intronic
1166687153 19:44802187-44802209 GCCTAGGAAGCTGAGGTTGCAGG + Intergenic
1166840796 19:45695771-45695793 GTCCAGGCAAGGGAGGGTGGGGG - Intronic
1167027759 19:46933742-46933764 GCCCAGGAAGCTGTGGTTGTAGG + Intronic
1167604246 19:50472785-50472807 ACTCAGGCAGCTGAGGTGGGAGG + Intronic
1167655025 19:50758207-50758229 CTCCAGGAAGCTGAGGTGGGAGG + Intergenic
1167937179 19:52918655-52918677 ACCCAGGAGGCTGAGGTTGGAGG + Intergenic
1168024749 19:53635841-53635863 GGCCAGCCAGCTAAGGCTGGTGG - Intronic
1168040106 19:53751736-53751758 GTTCAGGAGGCTGAGGTGGGAGG - Intergenic
1168345668 19:55649126-55649148 CTCCAGGCTGCCGTGGTTGGGGG + Intronic
1168415653 19:56166431-56166453 ACCCAGGAGGCTGAGGTTGGAGG + Intergenic
1168442477 19:56381746-56381768 GTTCAGGAAGCTGAGGTAGGAGG + Intronic
1168549755 19:57282880-57282902 GTGCAGGAGGCTGAGGTGGGAGG + Intronic
925248566 2:2408884-2408906 ACTCAGGAAGCTGAGGTTGGAGG + Intergenic
925311216 2:2883580-2883602 ACCCAGGAAGCTGAGGTGGGAGG - Intergenic
925776548 2:7341123-7341145 GTCCTGGCTGCTGAGGGTGAGGG - Intergenic
925955192 2:8956582-8956604 GCCCAGGAGGCTGAGGTGGGAGG + Intronic
926001791 2:9339223-9339245 GTCCCAGCAGGTGAGGCTGGTGG + Intronic
926040531 2:9669290-9669312 GTCCAGGCAGTTGAGGCAGAGGG - Intergenic
926158013 2:10468666-10468688 CTCCAGGAAGCTGAAGTGGGAGG - Intergenic
926234583 2:11029635-11029657 GTCCATGCAGCCGGGCTTGGTGG + Intergenic
927128849 2:20039603-20039625 ACTCAGGCAGCTGAGGTGGGAGG + Intronic
927486639 2:23492458-23492480 GTCCAATAAGCTGAGGCTGGAGG - Intronic
927671504 2:25072387-25072409 ATTCAGGAGGCTGAGGTTGGAGG - Intronic
927930064 2:27038232-27038254 GTCCAGGCAGGTGGGGTGGGAGG + Exonic
928084042 2:28334587-28334609 GTCCATGCAGCAGAGGTTGGTGG + Intronic
928153301 2:28852848-28852870 ATTCAGGAAGCTGAGGTGGGAGG + Intronic
928344925 2:30483242-30483264 CTTCAGGAGGCTGAGGTTGGGGG + Intronic
928443606 2:31313801-31313823 GTGGAGGAAGCTGGGGTTGGGGG - Intergenic
930007031 2:46906198-46906220 GTCCTGGCAGATGAGGATAGTGG - Intronic
930740302 2:54825751-54825773 ATTCAGGCAGCTGGGGGTGGGGG - Intronic
930797352 2:55407103-55407125 ATTCAGGAAGCTGAGGTAGGAGG + Intronic
931353445 2:61513166-61513188 TGCCAGGAAGCTGAGGTGGGAGG - Intronic
931379458 2:61738850-61738872 GCCCAGGAAGCTGAGGCTGCAGG + Intergenic
931493406 2:62774734-62774756 GTTCAGGAGGCTGAGGTGGGAGG + Intronic
931588891 2:63859099-63859121 ATCCAGGAGGCTGAGGTGGGAGG - Intronic
932006683 2:67934252-67934274 ACTCAGGAAGCTGAGGTTGGAGG - Intergenic
932181498 2:69650566-69650588 ATACAGGAAGCTGAGGTGGGTGG - Intronic
932413866 2:71562334-71562356 GTCCAGGCAGGGCAGGTTGTTGG - Intronic
932506614 2:72239005-72239027 GCCCAGGAGGCTGAGGTGGGAGG - Intronic
932617960 2:73247912-73247934 GTCCACACAGTTGAGGTAGGTGG + Exonic
932630245 2:73335712-73335734 CTCCAGGGGGCTGAGGTGGGAGG + Intergenic
932802660 2:74755676-74755698 ATTCAGGAAGCTGAGGTAGGAGG - Intergenic
933636466 2:84713685-84713707 GTCCATGGGGCTGGGGTTGGGGG + Intronic
933760288 2:85667797-85667819 GTCCAGGCAGCTGTGGTTTGGGG + Exonic
933941809 2:87251416-87251438 GTCCAGCCAGCTGAGGTACTTGG + Intergenic
934102962 2:88670569-88670591 CTTCAGGAAGCTGAGGTGGGTGG + Intergenic
934544765 2:95205790-95205812 GTCCAGGCAGCTAGGGCTGGTGG - Intergenic
934668811 2:96194242-96194264 GGCCTGGAAGCTGAGGTGGGAGG + Intronic
934945927 2:98541691-98541713 GTTCAGGAAGCTGAGGTAAGAGG - Intronic
936251960 2:110874142-110874164 CCCCAGGCTGCTGAGGGTGGGGG - Intronic
936338414 2:111610153-111610175 GTCCAGCCAGCTGAGGTACTTGG - Intergenic
936386315 2:112032723-112032745 GCTCAGGAAGCTGAGGTGGGAGG + Intergenic
937208233 2:120250759-120250781 TTAGAGGCAGCTGAGGCTGGTGG + Intronic
937920478 2:127125350-127125372 ACTCAGGAAGCTGAGGTTGGAGG + Intergenic
937924469 2:127157333-127157355 GTTCAGGAGGCTGAGGTGGGAGG + Intergenic
938031057 2:127993862-127993884 ATTCAGGCAGCTGAGGCAGGAGG - Intronic
938048052 2:128140783-128140805 TTCCAGGAAGCTGAGGCAGGAGG - Intronic
938515706 2:132004125-132004147 ATCCAGGAAGCTGAGGTGCGAGG + Intergenic
938795800 2:134718066-134718088 ATCCATCCAGATGAGGTTGGTGG + Intronic
940364611 2:152834065-152834087 ACCCAGGAGGCTGAGGTTGGAGG - Intergenic
941101753 2:161304291-161304313 GCTTAGGCAGCTGAGGTAGGAGG - Intergenic
941112172 2:161427467-161427489 GTCCACGCAGCAGATGGTGGCGG - Intronic
941561996 2:167058322-167058344 CTGCAGGAAGCTGAGGTGGGTGG - Intronic
943328184 2:186526420-186526442 ACTCAGGAAGCTGAGGTTGGAGG + Intergenic
944244427 2:197516524-197516546 GTCGGGGCCGCTGAGGTGGGAGG + Intronic
944558594 2:200912522-200912544 GCCCAGGAGGCTGAGGTGGGAGG - Intronic
944671858 2:202001072-202001094 GCTCAGGCGGCTGAGGTGGGAGG - Intergenic
944982211 2:205134277-205134299 CTTCAGGAGGCTGAGGTTGGTGG + Intronic
945231570 2:207595516-207595538 ACTCAGGAAGCTGAGGTTGGAGG - Intronic
945231591 2:207595671-207595693 GCTCAGGAAGCTGAGGTGGGAGG - Intronic
945770204 2:214033473-214033495 ATCCAGGCAGAAGAGTTTGGTGG + Intronic
946276166 2:218633472-218633494 GTCCCGGCAGGTGAGGCAGGAGG + Intronic
946741562 2:222807622-222807644 ATTCAGGAGGCTGAGGTTGGAGG - Intergenic
946954674 2:224916295-224916317 CTTCAGGAAGCTGAGGTGGGTGG + Intronic
947537087 2:230946841-230946863 GGCAAGGCAGCTGTGGCTGGGGG + Intronic
947572109 2:231244472-231244494 ATTCAGGAAGCTGAGGTGGGAGG - Intronic
947915338 2:233828805-233828827 GTCCCGGGAGCTGAGGGTGCAGG + Intronic
947977463 2:234379482-234379504 GTTCAGGAGGCTGAGGTGGGAGG - Intergenic
948603549 2:239120824-239120846 GACAAGGCAGCTGAGGGTGGAGG + Intronic
948630846 2:239301587-239301609 GTTCAGGAAGCTGAGGTGGGAGG - Intronic
948839763 2:240643150-240643172 GTCCTGGCAGCTGCAGCTGGTGG - Intergenic
948953809 2:241272344-241272366 GCCCAGGTCGCTGACGTTGGCGG - Intronic
1168769043 20:402602-402624 ACTCAGGAAGCTGAGGTTGGGGG - Intergenic
1168832211 20:852334-852356 CTGCAGTCAGCTGAGGGTGGGGG + Intronic
1169456370 20:5755800-5755822 CTCCAGGAAGCCGAGGTGGGCGG - Intronic
1170041549 20:12044977-12044999 ACCCAGGAGGCTGAGGTTGGAGG - Intergenic
1170219812 20:13930032-13930054 CTTCAGGAAGCTGAGGTGGGCGG - Intronic
1170903183 20:20486028-20486050 ATCCAGGAAGCCGAGGTAGGAGG + Intronic
1172152058 20:32797600-32797622 GTTCAGGAGGCTGAGGTGGGAGG - Intronic
1172260014 20:33555972-33555994 ATTCAGGAGGCTGAGGTTGGGGG - Intronic
1172289427 20:33765485-33765507 ACCCAGGAAGCTGAGGTGGGAGG - Intronic
1173621287 20:44438649-44438671 ATTCAGGAAGCTGAGGTAGGAGG - Intergenic
1173835708 20:46123974-46123996 TTCCAGGCAGATGAGTTTGATGG - Intronic
1173946042 20:46951745-46951767 GCCCAGGCAGGAGAGGATGGGGG + Intronic
1174107711 20:48174631-48174653 GTCCAGTCAGCTCAGGTTTTCGG - Intergenic
1174224598 20:48986806-48986828 GTTCAGGAGGCTGAGGTGGGAGG - Intronic
1174349287 20:49955540-49955562 ATCCAGGCAGCTGGTGATGGGGG + Intergenic
1174492456 20:50910476-50910498 ATACAGGCGGCTGAGGTGGGAGG + Intronic
1174537809 20:51266297-51266319 GTCATGGAAGCTGAGGCTGGAGG - Intergenic
1174585034 20:51601795-51601817 GTTCAGGAGGCTGAGGTGGGAGG + Intronic
1174595885 20:51683193-51683215 ATACAGGAAGCTGAGGTGGGAGG - Intronic
1175066349 20:56291823-56291845 TTCCAGGAGGCTGAGGTGGGAGG - Intergenic
1175610849 20:60349944-60349966 ATCCAGGAGGCTGAGGTTGAAGG - Intergenic
1176061853 20:63175976-63175998 GTCCAGGAAGCTAAGGGTGGGGG + Intergenic
1176126219 20:63476113-63476135 GCCCAGGAGGCTGAGGTGGGAGG + Intergenic
1176227254 20:64007752-64007774 GGCCAGGCAGCTGATTGTGGTGG - Intronic
1176520027 21:7817565-7817587 GCCCAGGCAGCTGAGCTTTCAGG + Exonic
1176778075 21:13158792-13158814 ATCCAGGAAGCTGAGGTGGGAGG - Intergenic
1177456220 21:21343518-21343540 GTCAAGGCTGCTGAGGGTGGTGG - Intronic
1177975697 21:27847798-27847820 ATCCAGGAAGCTGAGGTGGGAGG - Intergenic
1178223140 21:30683891-30683913 GTCTGGGCAGCGGAGGTTGTAGG + Intergenic
1178262407 21:31112036-31112058 GTTCAGGAGGCTGAGGTGGGAGG + Intergenic
1178389906 21:32189678-32189700 GTCAAGGGAGCTGAGTTTTGGGG - Intergenic
1178504147 21:33149566-33149588 GTCCAGGGAGCTGAGGCTCAGGG + Intergenic
1178654055 21:34447578-34447600 GCCCAGGCAGCTGAGCTTTCAGG + Intergenic
1178782877 21:35622818-35622840 GCCAAGGCAGCAGTGGTTGGGGG - Intronic
1179418260 21:41215497-41215519 CTCGAGGCCGCTGATGTTGGCGG + Intronic
1179418893 21:41220234-41220256 TTCCAGACAGCTGAGGTTCCCGG - Intronic
1179825502 21:43963464-43963486 TTCCAGGAAGCTGAGGCAGGAGG + Intronic
1180159624 21:45993246-45993268 GTCCACGGAGCTGAAGGTGGGGG - Intronic
1180648467 22:17359317-17359339 GTGCAGGAGGCTGAGGTGGGAGG - Intergenic
1180778257 22:18503894-18503916 ATTCAGGAAGCTGAGGTGGGAGG + Intergenic
1180969483 22:19807683-19807705 GTCCAAGCCCCTGAGGCTGGGGG + Intronic
1181086422 22:20441665-20441687 GTGGGGGCAGCTGGGGTTGGAGG - Exonic
1181103942 22:20560832-20560854 GTCCAGGCAGCCTAGCTTGGAGG + Intronic
1181502983 22:23329734-23329756 CTTCAGGAAGCTGAGGTGGGAGG + Intergenic
1181653787 22:24278109-24278131 CTTCAGGAAGCTGAGGTGGGAGG + Intronic
1181843028 22:25681448-25681470 GCCCAGGCACGTGAGGTTGGGGG + Intronic
1181848131 22:25729782-25729804 GCCCAGGCAGCTGTGGCTTGGGG - Intergenic
1181890447 22:26058399-26058421 GTGCATGAAGCTGAGGGTGGAGG + Intergenic
1182197911 22:28538191-28538213 ATTCAGGAAGCTGAGGCTGGAGG - Intronic
1182365014 22:29772757-29772779 GGCCAGGTAGATGAGGTTGAAGG + Intergenic
1182369675 22:29802008-29802030 GTCCAGCTGGCTGAGGGTGGGGG + Exonic
1182724410 22:32431818-32431840 GTCCATGTAACTGAGGTAGGTGG + Intronic
1182961175 22:34476655-34476677 CTTCAGGAAGCTGAGGTTGGTGG + Intergenic
1183092430 22:35531940-35531962 GTGCAGGCTGCTGATGATGGAGG - Intergenic
1183208106 22:36433203-36433225 GTCCAGGCAGCTCAGGGACGGGG + Intergenic
1183324743 22:37185156-37185178 GGCCAGGGAGCTGAGGTGGAGGG - Intronic
1183359267 22:37375034-37375056 GTCCAGGCGGCTGAGGCGGTTGG + Exonic
1183602078 22:38845518-38845540 GGGCAGGCAGCTGGGCTTGGAGG + Intergenic
1183627851 22:39015508-39015530 GTCCAGGCAGCTGTGTTCAGTGG + Intronic
1183772945 22:39942539-39942561 CTCCAGGAAGCTGAGGCAGGTGG + Intronic
1183784432 22:40021410-40021432 GTACCGGCAGCTGAGCCTGGCGG + Exonic
1183789321 22:40052563-40052585 GTTCAGGAGGCTGAGGTGGGAGG - Intronic
1183900346 22:41001096-41001118 ATCCAGGAAGCTGAGGTGGGAGG - Intergenic
1184279218 22:43427473-43427495 GGGCAGGCAGCAGGGGTTGGGGG + Intronic
1184322660 22:43754384-43754406 GGGCAGGCAGGGGAGGTTGGAGG - Intronic
1184503521 22:44888020-44888042 CTCCAGGCAGCTGAGGTGGTAGG + Exonic
1184569796 22:45315194-45315216 GTCCAAGCAGCTCTGTTTGGTGG + Intronic
1184879931 22:47298239-47298261 GTTCAGGCATCTGGGGTTGAAGG + Intergenic
1185078618 22:48696646-48696668 GTCCAGGCAGCTGATGGCTGGGG + Intronic
1185155079 22:49188632-49188654 CTCCGGGCAGCTGTGGTTGCAGG - Intergenic
1185175214 22:49322537-49322559 GTCCAGGCCCCCGAGGCTGGGGG - Intergenic
950031498 3:9856849-9856871 CTGCAGGGAGCTGAGGGTGGAGG - Intergenic
950478314 3:13227952-13227974 GGCCAGGCTGCTGGGGATGGTGG - Intergenic
950544542 3:13630594-13630616 GTCCAGGCCGGGGAGCTTGGTGG + Intronic
950782097 3:15400969-15400991 ATTCAGGAAGCTGAGGTGGGAGG - Intronic
951175002 3:19588940-19588962 GCTCAGGGAGCTGAGGTGGGAGG - Intergenic
951557797 3:23938316-23938338 ACCCAGGCAGCTGAGATGGGAGG - Intronic
951614891 3:24531498-24531520 CTCCGGGAAGCTGAGGTGGGAGG - Intergenic
951902550 3:27671120-27671142 CTCTAGGAAGCTGAGGTGGGTGG + Intergenic
951910063 3:27741007-27741029 ATTCAAGCAGCTGAGGTGGGAGG + Intergenic
952413172 3:33067405-33067427 GTCCGGGAGGCTGAGGTGGGAGG - Intronic
952427640 3:33191834-33191856 ACTCAGGCAGCTGAGGTGGGAGG + Intronic
952480440 3:33755434-33755456 CTTTAGGAAGCTGAGGTTGGAGG + Intergenic
953392704 3:42543118-42543140 GCCCAGGAAGCTGAGGCTGTAGG + Intergenic
953576330 3:44115802-44115824 CCTCAGGCAGCTGAGGTGGGAGG + Intergenic
954143617 3:48623011-48623033 CTTCAGGAAGCTGAGGTGGGTGG + Intergenic
954388364 3:50256179-50256201 GTTCAGGTAGCTGGGGATGGGGG - Exonic
954403617 3:50332681-50332703 GTTCAGGAGGCTGAGGTGGGAGG + Intronic
954458899 3:50615083-50615105 GGCTAGGCAGCTGAGGGTGGAGG - Intronic
954594066 3:51810426-51810448 GTCCAGGCAGCTTCATTTGGAGG + Intergenic
954911515 3:54114557-54114579 GGCCAGGCAGCAGTGGTGGGGGG + Intergenic
955250781 3:57279899-57279921 GTTCTGGCAGCGGGGGTTGGGGG + Intronic
955331783 3:58053290-58053312 ATTCAGGCAGCTGAGGCAGGAGG - Intronic
955973980 3:64463362-64463384 GTTCAGGAGGCTGAGGTGGGAGG - Intergenic
956113862 3:65899028-65899050 GCCCAGGAGGCTGAGGTGGGAGG - Intronic
956145408 3:66186650-66186672 GTTCAGTCAGCTCAGGTTTGGGG - Intronic
956182891 3:66533848-66533870 CTCTGGGCAGCTGAGGTGGGAGG - Intergenic
956644255 3:71440754-71440776 ACCCAGGAAGCTGAGGTGGGAGG + Intronic
956774162 3:72551068-72551090 GTCCAACCAGCTGTGGGTGGAGG + Intergenic
959062812 3:101631606-101631628 CCTCAGGCAGCTGAGGTGGGAGG + Intergenic
959473234 3:106778838-106778860 ACTCAGGCAGCTGAGGTGGGAGG - Intergenic
960110846 3:113843181-113843203 GTTCAGGAGGCTGAGGTGGGAGG - Intronic
961412285 3:126731029-126731051 GTTCAGGAAGCTGAGGCTGCAGG + Intronic
961715118 3:128852646-128852668 GTCCTGGCGGCTGACTTTGGTGG + Intergenic
961845579 3:129760342-129760364 GTTCAGGAGGCTGAGGTGGGAGG - Intronic
962316041 3:134360070-134360092 GGCCAGGCACCTGAGGTTGGGGG - Intronic
963210140 3:142680170-142680192 ACTCAGGAAGCTGAGGTTGGAGG - Intronic
963237670 3:142971602-142971624 GTACAGGAGGCTGAGGTGGGAGG + Intronic
964430285 3:156598588-156598610 GTCCAGGCTGCTGAGGCTATGGG + Intergenic
964572074 3:158118340-158118362 ATTCAGGAAGCTGAGGTGGGAGG - Intronic
964572434 3:158123397-158123419 ATTCAGGAAGCTGAGGTGGGAGG - Intronic
964636990 3:158868898-158868920 GTACAGGCAGCTGACATGGGTGG + Intergenic
964637244 3:158871103-158871125 GTCCAGGCAGCTGACATGGGTGG + Intergenic
965515264 3:169614767-169614789 GCCCAGGAAGCTGAGGCAGGAGG - Intronic
965720185 3:171652707-171652729 ATCCGGGAAGCTGAGGTGGGAGG - Intronic
965734645 3:171808155-171808177 CAGCATGCAGCTGAGGTTGGGGG - Intronic
966817453 3:183900768-183900790 ACTCAGGCAGCTGAGGTGGGAGG + Intergenic
967042259 3:185704556-185704578 GCTCAGGAAGCTGAGGTGGGAGG - Intronic
967881455 3:194304748-194304770 GCTCAGGAAGCTGAGGTGGGAGG - Intergenic
967914609 3:194569348-194569370 GTGCAGGAGGCTGAGGTGGGAGG + Intergenic
967997012 3:195174445-195174467 GTTCAGGAGGCTGAGGTGGGAGG - Intronic
968460303 4:721471-721493 GTCCAGGCTGCAGAGGGTGCCGG + Intronic
968527142 4:1066164-1066186 GTTCAGGAGGCTGAGGTGGGAGG - Intronic
968736953 4:2302513-2302535 ATCCAGGCAGCTGTGGATGTGGG - Intronic
968904415 4:3444882-3444904 GGCCAGGCAGCTGAGGCCCGAGG - Exonic
969592339 4:8129077-8129099 ATCCAGGAACCTGAGGCTGGGGG + Intronic
970575878 4:17427246-17427268 GTTCAGGAGGCTGAGGTGGGAGG - Intergenic
971345432 4:25807768-25807790 GCCCAGGTAGCTGAGATTGCTGG + Intronic
971369990 4:26011151-26011173 ATTCAGGAGGCTGAGGTTGGAGG - Intergenic
972346853 4:38199585-38199607 GTACAGGCAGATGAGGGTGCAGG - Intergenic
972598061 4:40547606-40547628 GTCCTGGGAGATGAGGTTGGGGG - Intronic
972695307 4:41439473-41439495 GCTCAGGAAGCTGAAGTTGGAGG + Intronic
973890455 4:55362700-55362722 CTTTAGGAAGCTGAGGTTGGAGG - Intronic
973949786 4:56000080-56000102 GCTCAGGAAGCTGAGGTGGGAGG + Intronic
974190552 4:58497018-58497040 GTTCAGGAAGCTGAGATGGGAGG - Intergenic
975481703 4:74888013-74888035 ATTCAGGAGGCTGAGGTTGGAGG + Intergenic
975490899 4:74987264-74987286 GTCCAATCAGCTGTGGTTGGAGG + Intronic
975990422 4:80254164-80254186 ACCCAGGAAGCTGAGGTGGGAGG - Intergenic
976400257 4:84598714-84598736 ATTCAGGAAGCTGAGGTAGGAGG - Intronic
976567427 4:86566960-86566982 ACCCAGGCAGCTGAGGTGGGAGG + Intronic
976689097 4:87849264-87849286 GTCCAGGAAGGTGAGGTTTGAGG - Intergenic
977251692 4:94695563-94695585 ATCCAGGAAGCCGAGGTGGGAGG + Intergenic
977540363 4:98311743-98311765 ATTCAGGAAGCTGAGGTGGGAGG - Intronic
977601035 4:98933844-98933866 GTTCAGGAGGCTGAGGTGGGAGG - Intergenic
978498107 4:109381450-109381472 ATCCAAGCAGCTGTGGTTTGGGG + Intergenic
978502720 4:109426272-109426294 GCTCAGGAAGCTGAGGTGGGAGG - Intergenic
979683836 4:123489623-123489645 ATTCAGGAGGCTGAGGTTGGGGG - Intergenic
980027789 4:127786572-127786594 ATTCAGGAAGCTGAGGTGGGAGG - Intronic
980952178 4:139391939-139391961 GTTCAGGAGGCTGAGGTGGGAGG - Intronic
981695472 4:147554831-147554853 ACTCAGGCGGCTGAGGTTGGAGG + Intergenic
981697810 4:147576282-147576304 ACTCAGGAAGCTGAGGTTGGAGG - Intergenic
982042052 4:151407090-151407112 ATCCAGGAGGCTGAGGTGGGAGG - Intergenic
982107584 4:152024250-152024272 ATCCAGGCAGCTGTGGATGGAGG - Intergenic
983603258 4:169554307-169554329 GTTCAGGAGGCTGAGGTGGGAGG + Intronic
984248379 4:177302835-177302857 GTTCAGGAAGCTGAGGCAGGAGG + Intergenic
984351703 4:178602337-178602359 ATGCAGGAAGCTGAGGTGGGAGG + Intergenic
985502233 5:255565-255587 GCCCAGGAAGCTGAGGTGGGAGG - Intronic
985734801 5:1573172-1573194 GCCCAGGAGGCTGAGGTGGGAGG + Intergenic
985771665 5:1815572-1815594 CTCCAGGCCGCTGAGGTGTGGGG + Intronic
985778074 5:1855559-1855581 GGCCAGGCAGTTGAAGCTGGAGG + Intergenic
985848791 5:2373623-2373645 GTGAAGGCTCCTGAGGTTGGTGG + Intergenic
986365206 5:7022245-7022267 GCCCAGGCACCTGAGCTGGGAGG + Intergenic
986821978 5:11477518-11477540 ACTCAGGCAGCTGAGGTGGGAGG - Intronic
988301157 5:29429197-29429219 GTCTGGGAAGCTGAGGTGGGAGG + Intergenic
988726995 5:33936242-33936264 CTCCAGGAAGCTGAGCGTGGTGG + Intergenic
988790299 5:34601643-34601665 CTCCAGGAAGCTGAGTGTGGAGG + Intergenic
990221880 5:53600550-53600572 CTTCAGGAAGCTGAGGTGGGTGG - Intronic
990293215 5:54375963-54375985 GCTCAGGAAGCTGAGGTGGGAGG + Intergenic
991047830 5:62241266-62241288 GTCCTTGGAGCTGAGGTGGGAGG - Intergenic
991245239 5:64503342-64503364 GTCCACTCAGCTCAGGTTGTAGG + Intergenic
991304173 5:65159207-65159229 GTCCAGGCAAGAGAGGATGGAGG - Intronic
991637911 5:68724752-68724774 GTCCAAGCAGCTGTGGTTGAGGG + Intergenic
991694644 5:69258965-69258987 GCTCAGGAGGCTGAGGTTGGGGG + Intronic
991902815 5:71477264-71477286 GTCCAGGAGGCTGAGGCAGGAGG - Intronic
992031047 5:72721774-72721796 ATTCAGGCAGATAAGGTTGGTGG - Intergenic
992389969 5:76321630-76321652 GTTCAGGAGGCTGAGGTGGGAGG + Intronic
992800507 5:80291378-80291400 GTGCAGGAGGCTGAGGTGGGAGG - Intergenic
993199105 5:84789680-84789702 GTCAACGCAGATGAGGCTGGAGG + Intergenic
994116111 5:96062857-96062879 GTCAAGGCAGCTTAACTTGGGGG - Intergenic
994979276 5:106852439-106852461 GAACAAGCAGCTGAAGTTGGAGG - Intergenic
995517428 5:112968052-112968074 TTTAAGGAAGCTGAGGTTGGGGG - Intergenic
996167490 5:120243076-120243098 ATTCAGGAAGCTGAGGTGGGAGG - Intergenic
997306020 5:132837079-132837101 CTCCAGGGAGCTGAGGCGGGAGG + Intergenic
997556521 5:134804039-134804061 ATTCAGGAAGCTGAGGTGGGAGG - Intronic
997863195 5:137438223-137438245 GTCCAGGCAGGAGATGATGGCGG + Intronic
997925780 5:138030353-138030375 GCTCAGGGAGCTGAGGTGGGAGG - Intronic
997950189 5:138236525-138236547 GCCCAGGAGGCTGAGGTGGGAGG - Intergenic
998068545 5:139178468-139178490 GAGGAGCCAGCTGAGGTTGGAGG - Intronic
998365133 5:141625512-141625534 GTAGAGGCAGTTGGGGTTGGTGG - Intronic
998429251 5:142056545-142056567 ATCCAGGAGGCTGAGGTGGGAGG - Intergenic
999161849 5:149507568-149507590 ACTCAGGAAGCTGAGGTTGGAGG - Intronic
999223340 5:149999999-150000021 GTCCAGGCAGGAGATGATGGTGG + Intronic
999303859 5:150507595-150507617 GGCCTGGCAGCTGAGCTGGGTGG + Intronic
999327045 5:150650044-150650066 GTCCAAGGAGCTGGGCTTGGCGG - Exonic
999376101 5:151087353-151087375 TTCCAGGGAGTTGGGGTTGGGGG + Intronic
999406753 5:151313278-151313300 GTCCTTGCAGCAGGGGTTGGGGG + Intergenic
1000244774 5:159440373-159440395 GACCAGGCAGCACAGGTAGGTGG - Intergenic
1000246591 5:159453394-159453416 GTTCAGTCAGCTGTGGTCGGTGG + Intergenic
1001075933 5:168628104-168628126 GGGCAGGGAGCTGAGGTTGGTGG + Intergenic
1001242175 5:170079317-170079339 GCCCAGGCAGCTGGGGTGGCTGG + Intronic
1001684550 5:173583772-173583794 GTCCTGGAAGCTGAGGGAGGTGG - Intergenic
1001916166 5:175561900-175561922 GCTCAGGAAGCTGAGGTGGGAGG + Intergenic
1002019612 5:176354616-176354638 GCAAAGGCAGCTGAGGCTGGAGG + Intronic
1002118841 5:176985711-176985733 GCACAGGAAGCTGAGGTGGGAGG - Intronic
1002220328 5:177674559-177674581 ACTCAGGCAGCTGAGGTAGGAGG + Intergenic
1002272915 5:178084566-178084588 GCTCAGGAAGCTGAGGTGGGAGG - Intergenic
1002609808 5:180409003-180409025 GCTCAGGAAGCTGAGGTGGGAGG + Intergenic
1002820562 6:720579-720601 GTCCTAGCTGCTGAGGGTGGAGG + Intergenic
1003033351 6:2621800-2621822 CTCCAGGAAGCTGAGGCTGTGGG - Intergenic
1003097343 6:3152921-3152943 GCTCAGGAAGCTGAGGTGGGAGG + Exonic
1003548498 6:7081474-7081496 GCCCAGGAGGCTGAGGTAGGAGG + Intergenic
1003605320 6:7554751-7554773 ACTCAGGCAGCTGAGGTGGGAGG - Intronic
1004032042 6:11880087-11880109 GTCCAGGCATGTGAGGATGAAGG + Intergenic
1004081792 6:12402103-12402125 GTCCAGTAAGCTGAGGATGTAGG + Intergenic
1004463023 6:15856643-15856665 ATTCAGGAAGCTGAGGTGGGAGG - Intergenic
1004573199 6:16867906-16867928 CTCCAGGACGCTGAGGTAGGAGG + Intergenic
1004986360 6:21087436-21087458 CTTCAGGAAGCTGAGGCTGGAGG - Intronic
1006194742 6:32232240-32232262 ATCCAGGAAGCTGAGGCAGGAGG - Intergenic
1006330063 6:33383918-33383940 GTCTGGGGAGCTGAGGCTGGCGG - Intergenic
1006350223 6:33515446-33515468 ACCCAGGAAGCTGAGGTGGGAGG + Intergenic
1006457024 6:34137690-34137712 GTTCAGGAGGCTGAGGTAGGAGG - Intronic
1006601793 6:35231244-35231266 GGCCATGGTGCTGAGGTTGGAGG - Intronic
1006850581 6:37095113-37095135 ATTCAGGAAGCTGAGGTGGGAGG + Intergenic
1006937892 6:37731161-37731183 GCCCAGGAGGCTGAGGTGGGAGG - Intergenic
1006953334 6:37844024-37844046 GCTCAGGAAGCTGAGGTGGGAGG - Intronic
1006956483 6:37878003-37878025 GTCCAGGCAGGAGATGATGGTGG + Intronic
1007668288 6:43529815-43529837 CTTCAGGAAGCTGAGGTGGGAGG + Intronic
1007833684 6:44657810-44657832 CTGCAGACAGCTGAGGTTGAGGG - Intergenic
1007993417 6:46281090-46281112 GGTCAGGCAGCTGAGGTTTGGGG + Intronic
1008535934 6:52506121-52506143 GCCCAGGCGGCTCAGGCTGGGGG + Exonic
1009585619 6:65597989-65598011 GCTCAGGAAGCTGAGGTGGGAGG + Intronic
1010423473 6:75700606-75700628 GTCCAAGCTACTGGGGTTGGAGG - Intronic
1010428822 6:75755122-75755144 GTGTAGGAGGCTGAGGTTGGAGG + Intronic
1010783709 6:79975042-79975064 GTCCAAGCAGCAGATGATGGTGG - Intergenic
1011131655 6:84058243-84058265 GTCCAGGCAGCTGATGATGGTGG + Intronic
1011416404 6:87124132-87124154 ACTCAGGAAGCTGAGGTTGGAGG + Intergenic
1011422452 6:87187604-87187626 GTTCAGGAGGCTGAGGTGGGAGG + Intronic
1011473591 6:87731618-87731640 TACCAGGCTGCTGAGGTGGGAGG - Intergenic
1011479420 6:87779350-87779372 ATTCAGGAAGCTGTGGTTGGAGG - Intergenic
1012511422 6:100006249-100006271 ATTCAGGCAGCTGAGGTGGGAGG + Intergenic
1013115733 6:107102488-107102510 GCTCATGCAGCTGAGGTGGGAGG + Intronic
1013289571 6:108708688-108708710 TGCCAGCCAGCTGAGGATGGGGG - Intergenic
1013354283 6:109333576-109333598 CTTCAGGAGGCTGAGGTTGGAGG - Intergenic
1013460050 6:110366050-110366072 GTTCAGGAGGCTGAGGTGGGAGG + Intergenic
1013955830 6:115839211-115839233 GTCAAGGCAGGAGAGGTTGTAGG - Intergenic
1014402957 6:121013800-121013822 ATCCAGGAGGCTGAGGTGGGAGG + Intergenic
1014419151 6:121219187-121219209 TTCCAGGAAGCTTAGGGTGGAGG + Intronic
1015252900 6:131145650-131145672 CACCAGGAAGCTGAGGTGGGAGG - Intronic
1016099278 6:140077354-140077376 GTCCCAGCTGCTGAGGTGGGAGG + Intergenic
1016401166 6:143682324-143682346 GCTCAGGAGGCTGAGGTTGGAGG - Intronic
1016901655 6:149108792-149108814 GGGCAGGCTGCTGAGGTGGGAGG - Intergenic
1017213029 6:151878056-151878078 CTTCAGGAAGCTGAGGTGGGAGG - Intronic
1017712371 6:157182138-157182160 GTTCAGGAGGCTGAGGTGGGAGG + Intronic
1017870601 6:158483439-158483461 GCCCAGGAGGCTGAGGTGGGAGG - Intronic
1018002709 6:159593862-159593884 ATTCAGGAAGCTGAGGTGGGAGG - Intergenic
1018115618 6:160581406-160581428 ATTCAGGAAGCTGAGGTGGGAGG - Intronic
1018422329 6:163650246-163650268 GTCCAGCCAGCAGAGGAGGGAGG - Intergenic
1019466023 7:1189476-1189498 CTCCAGGAGGCTGAGGCTGGAGG + Intergenic
1020110674 7:5446262-5446284 GCCCAGCAAGCTGAGGTAGGAGG - Intronic
1020225655 7:6277949-6277971 TTCCAGGAGGCTGAGGTGGGAGG - Intergenic
1021516113 7:21489427-21489449 ACTCAGGCAGCTGAGGTGGGAGG - Intronic
1021996081 7:26179389-26179411 ATCCAGGAGGCTGAGGTGGGAGG + Intronic
1022157567 7:27675660-27675682 GTTCAGGAGGCTGAGGTGGGGGG - Intergenic
1022301311 7:29105251-29105273 GTCCAGTCAGCTGAGACTGAAGG - Intronic
1022864094 7:34399400-34399422 GTCAAGGGAGATGAGGTGGGTGG - Intergenic
1023162754 7:37313331-37313353 GTTCGGGAAGCTGAGGTGGGAGG - Intronic
1023447719 7:40249181-40249203 ACTCAGGCAGCTGAGGTGGGAGG + Intronic
1023844224 7:44112078-44112100 GTCCAGGCAGCTGGGGGTTGTGG + Intronic
1023867938 7:44247608-44247630 GTCAAGGCGGCTGGGGGTGGGGG + Intronic
1024200024 7:47097134-47097156 GACCTGGCAGCTGAGGGTGTGGG + Intergenic
1024758437 7:52564423-52564445 GTACTTGAAGCTGAGGTTGGAGG + Intergenic
1025029553 7:55545956-55545978 ATTCAGGAAGCTGAGGTGGGAGG + Intronic
1025917789 7:65879958-65879980 ACTCAGGAAGCTGAGGTTGGAGG - Intronic
1026353300 7:69536040-69536062 ACTCAGGAAGCTGAGGTTGGAGG + Intergenic
1026703595 7:72670020-72670042 GCTCCGGCAGCTGAGGTGGGAGG + Intronic
1026790132 7:73325994-73326016 ACTCAGGCAGCTGAGGTAGGAGG - Intronic
1026945036 7:74310411-74310433 ACCCAGGAAGCTGAGGTGGGAGG + Intronic
1027395923 7:77754144-77754166 ACCCAGGAAGCTGAGGTGGGAGG - Intronic
1027928518 7:84499389-84499411 CTCCAGGGAGCTGAGGCAGGAGG + Intergenic
1028168583 7:87568024-87568046 GCCCAGGAAGCAGAGGTTGCCGG + Intronic
1028179543 7:87702385-87702407 ACTCAGGAAGCTGAGGTTGGAGG - Intronic
1028223700 7:88225221-88225243 AACCAGGAAGCTGATGTTGGAGG + Intronic
1028654883 7:93193680-93193702 GTTCAGGAAGCTGAGTTAGGAGG - Intronic
1028687729 7:93611333-93611355 GTGCAGGCAGCTGTGGATGAAGG + Intronic
1029294426 7:99528533-99528555 ATGCAGGAAGCTGAGGTGGGAGG - Intronic
1029457676 7:100679262-100679284 TGCCAGGCAGCTGGGGCTGGGGG + Intergenic
1029476758 7:100789564-100789586 CTCCGGGAAGCTGAGGTGGGAGG + Intronic
1030027985 7:105343323-105343345 ATACAGGAAGCTGAGGTGGGGGG + Intronic
1030125274 7:106147349-106147371 ATTCAGGAGGCTGAGGTTGGAGG - Intergenic
1030229889 7:107196751-107196773 ATTCAGGAAGCTGAGGTGGGAGG - Intronic
1030272147 7:107681339-107681361 TTCCAGAGAGCTGAGGTTGCTGG + Intronic
1030447259 7:109662486-109662508 GTTCAGCCAGCTGTGGTTGAGGG - Intergenic
1030546297 7:110900441-110900463 GTCCAGGAAGGAGAAGTTGGTGG - Intronic
1032039950 7:128551047-128551069 GTCCAGGAGGCTGAAGTGGGAGG + Intergenic
1032453745 7:132056273-132056295 GACCAGGCAGGTGATGCTGGAGG + Intergenic
1032669720 7:134072016-134072038 GCTCAGGCAGCTGTGGGTGGAGG - Intergenic
1032721026 7:134551077-134551099 ATCGAGGGAGCTGAGGGTGGAGG - Intronic
1032769793 7:135039656-135039678 GCCCAGGAAGCAGAGGTTGCAGG + Intronic
1032839018 7:135699375-135699397 TTCCAGGAAGATGAGGCTGGTGG + Exonic
1033614571 7:143001396-143001418 ATTCAGGCGGCTGAGGTGGGAGG + Intergenic
1033874271 7:145795107-145795129 GCTCAGGAAGCTGAGGTGGGAGG + Intergenic
1033977216 7:147116751-147116773 ATGCAGGCAGGTGTGGTTGGAGG + Intronic
1035351734 7:158252154-158252176 CTCCAAGCAGCTGAGGCTTGAGG - Intronic
1036181857 8:6592761-6592783 ACCCAGGAGGCTGAGGTTGGAGG - Intronic
1036668037 8:10760721-10760743 CAACAGGCAGCTGAGGTGGGAGG + Intronic
1036784319 8:11675827-11675849 GGCCAGGATGCTGAGCTTGGTGG - Intergenic
1036938151 8:13025273-13025295 CTTCAGGAAGCTGAGGTGGGTGG + Exonic
1037536732 8:19831579-19831601 ATTCAGGAAGCTGAGGTAGGAGG + Intronic
1037573718 8:20180889-20180911 GTCCCGGCAGCTGGTGCTGGTGG - Exonic
1037837962 8:22225374-22225396 GGCCAGGAAGCTGAGGAGGGAGG + Intronic
1038076849 8:24085480-24085502 GTTTGGGCAGCTGAGGTGGGAGG - Intergenic
1038164765 8:25074873-25074895 ACTCAGGCAGCTGAGGTGGGAGG - Intergenic
1038344257 8:26717801-26717823 GTCCAGGAGGCTGAGGCAGGAGG - Intergenic
1038955119 8:32459526-32459548 CTCCAGGAGGCTGAGGTGGGAGG + Intronic
1039256391 8:35723511-35723533 GTCCCAGCTGCTGAGGTGGGAGG - Intronic
1039536814 8:38323717-38323739 CTCCAGGAGGCTGAGGTAGGAGG + Intronic
1039767065 8:40640083-40640105 ATCCAGGAGGCTGAGGTGGGAGG - Intronic
1039822294 8:41144940-41144962 GTCCAGGCAGCAGACTTTGAGGG - Intergenic
1039901595 8:41756684-41756706 CTCCAGGAGGCTGAGGTGGGCGG - Intronic
1040508223 8:48070901-48070923 ATTCAGGAAGCTGAGGTGGGAGG - Intergenic
1040528259 8:48243384-48243406 GTCCTTACAGCTGAGGTAGGTGG + Intergenic
1041092981 8:54320062-54320084 GTTCAGGAGGCTGAGGTGGGAGG + Intergenic
1041729714 8:61051815-61051837 GGCCTGGCAGCTGCAGTTGGGGG - Intergenic
1041803879 8:61828928-61828950 GTTCAGGAGGCTGAGGTAGGAGG - Intergenic
1042234044 8:66589963-66589985 ACCCAGGAAGCTGAGGTGGGAGG + Intronic
1042245808 8:66707732-66707754 CTTCAGGAAGCTGAGGTGGGCGG + Intronic
1042282816 8:67072756-67072778 GTTCAGGAGGCTGAGGTGGGAGG + Intronic
1042594101 8:70427026-70427048 CTTCAGGAGGCTGAGGTTGGAGG - Intergenic
1042604121 8:70528926-70528948 GTCCAGGCCACTGACGTTGAAGG + Intergenic
1042864562 8:73345783-73345805 GCCCAGGCAGCTGTGGTCTGGGG + Intergenic
1042926379 8:73972144-73972166 GAGCAGGCAGCTGGGGGTGGGGG - Intronic
1043009297 8:74861871-74861893 TTCCAGGCAGCGGAAGATGGAGG + Intergenic
1043941198 8:86197671-86197693 GTCCAGGCAGTCAAGGTTGCAGG - Intergenic
1044679911 8:94766959-94766981 ATTCAGGAAGCTGAGGTGGGAGG + Intronic
1044833676 8:96275402-96275424 GCTCAGGCAGCTGAGGATGGAGG - Intronic
1044837677 8:96312205-96312227 ATCCAGGAGGCTGAGGTGGGAGG + Intronic
1045109512 8:98926898-98926920 TTCCAGGCAGCAGTGGTGGGTGG + Intronic
1045598786 8:103690205-103690227 CTTCAGGAAGCTGAGGTGGGGGG - Intronic
1047740438 8:127802320-127802342 GCCCAGGAGGCTGAGGTGGGAGG - Intergenic
1047948805 8:129910552-129910574 CTTCAGGAAGCTGAGGTGGGAGG + Intronic
1048146202 8:131846251-131846273 GGCCAGGAGGCTGAGGTGGGAGG + Intergenic
1049513022 8:143039328-143039350 GTCAGGGAAGCTGAGGCTGGGGG - Exonic
1049581669 8:143414474-143414496 ACCCAGGAGGCTGAGGTTGGAGG - Intergenic
1049734126 8:144194797-144194819 ATTCAGGAGGCTGAGGTTGGAGG + Intronic
1049971444 9:825483-825505 GTACAGGAGGCTGAGGTGGGAGG + Intergenic
1051129282 9:13841421-13841443 TTCCAGACTCCTGAGGTTGGAGG + Intergenic
1051407692 9:16756452-16756474 CTCCAAGAAGCTGAGGTAGGAGG - Intronic
1051413276 9:16812484-16812506 CTGCAGGCAGGTGAGGTTTGTGG - Intronic
1051741850 9:20259973-20259995 ACCCAGGAGGCTGAGGTTGGAGG + Intergenic
1052366318 9:27615493-27615515 ATTCAGGAAGCTGAGGTGGGAGG - Intergenic
1052747275 9:32452853-32452875 GTTCAGGAGGCTGAGGTGGGAGG + Exonic
1052827087 9:33185071-33185093 GCCCAGACAGCTGTGGCTGGAGG - Intergenic
1052932619 9:34068097-34068119 GTCCAGTCAGCTGAGGTTGGTGG + Intergenic
1053187846 9:36034118-36034140 ATTCAGGCAGCTGAGGTGGGAGG + Intergenic
1055945481 9:81688547-81688569 GCCCGGGCAGCTGAGGCCGGGGG - Exonic
1056646487 9:88416432-88416454 GTTCAGGAGGCTGAGGTGGGAGG - Intronic
1056811848 9:89771244-89771266 GTCCAGACAGCTGAACGTGGTGG + Intergenic
1058692504 9:107531582-107531604 GCTGAGGCAGCTGAGGTGGGAGG - Intergenic
1058996800 9:110307048-110307070 ATTCAGGAAGCTGAGGTGGGAGG - Intronic
1059093223 9:111383811-111383833 CTCCAGGAGGCTGAGGTGGGAGG + Intronic
1059197808 9:112387326-112387348 ACTCAGGAAGCTGAGGTTGGAGG - Intronic
1059484694 9:114617677-114617699 GTTCAGGGGGCTGAGGTGGGAGG - Intronic
1060086921 9:120712147-120712169 GCTCAGGAAGCTGAGGTGGGAGG + Intronic
1060480010 9:124012275-124012297 CGCCAGGCAGCTGAGGCGGGGGG + Exonic
1060507524 9:124209320-124209342 CTTCAGGAAGCTGAGGTGGGCGG - Intergenic
1060511597 9:124238724-124238746 ATTCAGGAAGCTGAGGTGGGAGG - Intergenic
1062250123 9:135589608-135589630 CTCCTGGCAGCTGAGCCTGGGGG + Intergenic
1062258414 9:135643055-135643077 GCTCAGGAAGCTGAGGTGGGAGG + Intergenic
1062279816 9:135746922-135746944 GTACAGGAGCCTGAGGTTGGTGG + Intronic
1062406560 9:136399654-136399676 GTCCCCGCAGCTGGGGCTGGAGG - Intergenic
1185860852 X:3577990-3578012 AGCCAGGAAGCTGAGGATGGAGG + Intergenic
1186269142 X:7866191-7866213 GTCCAGTCAGCTGAGGTTTGAGG + Intergenic
1187073734 X:15913935-15913957 ATCCAGGAGGCTGAGGTGGGAGG - Intergenic
1187537710 X:20158254-20158276 GTTCAGGAGGCTGAGGTGGGAGG + Intronic
1188623214 X:32251873-32251895 ACCCAGGAAGCTGAGGTAGGAGG + Intronic
1188738673 X:33750124-33750146 ATCCAGGAGGCTGAGGTGGGAGG - Intergenic
1189333965 X:40158663-40158685 GCCGAGGCAGCTGGGGGTGGGGG + Intronic
1189528273 X:41850069-41850091 ATTCAGGCGGCTGAGGTGGGAGG + Intronic
1189685115 X:43555781-43555803 GTTCAGGAGGCTGAGGTGGGAGG + Intergenic
1190717915 X:53119826-53119848 ACCCAGGAAGCTGAGGTGGGAGG - Intergenic
1191018229 X:55833351-55833373 GTCCAGGTGGGTGAGGTTGGTGG + Intergenic
1191114235 X:56835364-56835386 TCTCAGGAAGCTGAGGTTGGAGG - Intergenic
1192926598 X:75760349-75760371 GGCTAGGCAGCTGGGGGTGGTGG - Intergenic
1194226062 X:91259386-91259408 GTTCGGGAAGCTGAGGCTGGAGG - Intergenic
1196026152 X:111043183-111043205 ATTCAGGCAGCTGAGGCAGGAGG + Intronic
1196152605 X:112391943-112391965 GTCCAGTCAGCCCAGGATGGAGG + Intergenic
1197872852 X:131075781-131075803 TTCCAGGCAGCAGATGTTGGTGG + Intronic
1197935237 X:131734019-131734041 CTCCAGGCAGCTATGTTTGGTGG + Intergenic
1198085512 X:133278561-133278583 ATTCAGGAAGCTGAGGTGGGAGG + Intergenic
1198093763 X:133357494-133357516 GTTCAGGAGGCTGAGGTGGGAGG - Intronic
1198202076 X:134431724-134431746 GTTCAGGAGGCTGAGGTGGGAGG + Intergenic
1198472156 X:136957230-136957252 ACCCAGGAAGCTGAGGTGGGAGG - Intergenic
1199447260 X:147939787-147939809 ATCCAGGAGGCTGAGGTGGGAGG + Intronic
1200110395 X:153737947-153737969 GGGCAGGCAGCTGAGGGTAGAGG + Intronic
1201286782 Y:12385818-12385840 CTTTAGGAAGCTGAGGTTGGTGG - Intergenic
1201369073 Y:13240883-13240905 GCTCAGGGAGCTGAGGTGGGAGG + Intergenic
1201791429 Y:17845464-17845486 ATCCAGGAAGCTGAGGTTACCGG - Intergenic
1201810125 Y:18060525-18060547 ATCCAGGAAGCTGAGGTTACCGG + Intergenic
1202172788 Y:22068682-22068704 GAGCAGGCAGCTGGGGTTGGGGG + Intergenic
1202218574 Y:22517689-22517711 GAGCAGGCAGCTGGGGTTGGGGG - Intergenic
1202324612 Y:23678366-23678388 GAGCAGGCAGCTGGGGTTGGGGG + Intergenic
1202343996 Y:23902318-23902340 GTACAGGGAGCTGAGGTGGAAGG - Intergenic
1202526772 Y:25767765-25767787 GTACAGGGAGCTGAGGTGGAAGG + Intergenic
1202546159 Y:25991688-25991710 GAGCAGGCAGCTGGGGTTGGGGG - Intergenic