ID: 1072664648

View in Genome Browser
Species Human (GRCh38)
Location 10:97384566-97384588
Sequence CTGCCTGGACGGAGACCCTG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1072664640_1072664648 -1 Left 1072664640 10:97384544-97384566 CCTTAAGTACCCCCAACCTCAGC 0: 1
1: 1
2: 4
3: 40
4: 218
Right 1072664648 10:97384566-97384588 CTGCCTGGACGGAGACCCTGAGG No data
1072664639_1072664648 11 Left 1072664639 10:97384532-97384554 CCAGGATGAAGGCCTTAAGTACC 0: 1
1: 0
2: 1
3: 4
4: 87
Right 1072664648 10:97384566-97384588 CTGCCTGGACGGAGACCCTGAGG No data
1072664638_1072664648 20 Left 1072664638 10:97384523-97384545 CCTCAGCAGCCAGGATGAAGGCC 0: 2
1: 1
2: 5
3: 38
4: 322
Right 1072664648 10:97384566-97384588 CTGCCTGGACGGAGACCCTGAGG No data
1072664636_1072664648 26 Left 1072664636 10:97384517-97384539 CCATAACCTCAGCAGCCAGGATG 0: 2
1: 1
2: 5
3: 21
4: 234
Right 1072664648 10:97384566-97384588 CTGCCTGGACGGAGACCCTGAGG No data
1072664642_1072664648 -10 Left 1072664642 10:97384553-97384575 CCCCCAACCTCAGCTGCCTGGAC 0: 1
1: 1
2: 8
3: 82
4: 836
Right 1072664648 10:97384566-97384588 CTGCCTGGACGGAGACCCTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1072664648 Original CRISPR CTGCCTGGACGGAGACCCTG AGG Intronic
No off target data available for this crispr