ID: 1072664684

View in Genome Browser
Species Human (GRCh38)
Location 10:97384715-97384737
Sequence CAGCCTGGACGGAGACCCTG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1072664677_1072664684 -1 Left 1072664677 10:97384693-97384715 CCCTAAGTACTCCCAACCTCAGC 0: 1
1: 1
2: 0
3: 21
4: 146
Right 1072664684 10:97384715-97384737 CAGCCTGGACGGAGACCCTGAGG No data
1072664673_1072664684 26 Left 1072664673 10:97384666-97384688 CCATAACCTCAGCAGCCAGGATG 0: 2
1: 1
2: 5
3: 21
4: 234
Right 1072664684 10:97384715-97384737 CAGCCTGGACGGAGACCCTGAGG No data
1072664675_1072664684 20 Left 1072664675 10:97384672-97384694 CCTCAGCAGCCAGGATGAAGGCC 0: 2
1: 1
2: 5
3: 38
4: 322
Right 1072664684 10:97384715-97384737 CAGCCTGGACGGAGACCCTGAGG No data
1072664676_1072664684 11 Left 1072664676 10:97384681-97384703 CCAGGATGAAGGCCCTAAGTACT 0: 1
1: 0
2: 1
3: 5
4: 65
Right 1072664684 10:97384715-97384737 CAGCCTGGACGGAGACCCTGAGG No data
1072664678_1072664684 -2 Left 1072664678 10:97384694-97384716 CCTAAGTACTCCCAACCTCAGCA 0: 1
1: 0
2: 1
3: 17
4: 187
Right 1072664684 10:97384715-97384737 CAGCCTGGACGGAGACCCTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1072664684 Original CRISPR CAGCCTGGACGGAGACCCTG AGG Intronic
No off target data available for this crispr